miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-494-3p | ||||
miRNA Stemloop AC | MI0003134 | ||||
miRNA Stemloop ID | hsa-mir-494 | ||||
Sequence | ugaaacauacacgggaaaccuc | ||||
TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [2] | ||
Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [3] | ||
C-X-C chemokine receptor type 4 (CXCR4) | Successful Target | Target Info | [4] | ||
Cannabinoid receptor 1 (CB1) | Successful Target | Target Info | [5] | ||
cAMP-dependent chloride channel (CFTR) | Successful Target | Target Info | [6] | ||
ERK activator kinase 1 (MEK1) | Clinical trial Target | Target Info | [3] | ||
RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [7] | ||
Apoptosis inhibitor survivin (BIRC5) | Clinical trial Target | Target Info | [8] | ||
Syndecan-1 (SDC1) | Clinical trial Target | Target Info | [9] | ||
Tissue factor pathway inhibitor (TFPI) | Clinical trial Target | Target Info | [10] | ||
Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [11] | ||
Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [12] | ||
Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [13] | ||
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) | Literature-reported Target | Target Info | [14] | ||
IP3 receptor isoform 1 (ITPR1) | Literature-reported Target | Target Info | [3] | ||
Myosin-2 (MYH2) | Literature-reported Target | Target Info | [15] | ||
Protein(s) Regulated by This miRNA | Aryl hydrocarbon receptor nuclear translocator-like protein 1 | Regulated Protein | [16] | ||
BAG family molecular chaperone regulator 1 | Regulated Protein | [17] | |||
Bcl-2-like protein 11 | Regulated Protein | [18] | |||
Chloride anion exchanger | Regulated Protein | [19] | |||
Colorectal mutant cancer protein | Regulated Protein | [20] | |||
Forkhead box protein J3 | Regulated Protein | [21] | |||
Heterogeneous nuclear ribonucleoprotein A3 | Regulated Protein | [22] | |||
Heterogeneous nuclear ribonucleoprotein Q | Regulated Protein | [22] | |||
Homeobox protein Hox-A10 | Regulated Protein | [23] | |||
Microtubule-associated proteins 1A/1B light chain 3B | Regulated Protein | [24] | |||
Protein disulfide-isomerase A3 | Regulated Protein | [22] | |||
Rho GTPase-activating protein 5 | Regulated Protein | [25] | |||
Transcription factor A, mitochondrial | Regulated Protein | [21] | |||
UDP-glucuronosyltransferase 2B17 | Regulated Protein | [26] | |||
UV excision repair protein RAD23 homolog B | Regulated Protein | [22] | |||
Vitamin K-dependent protein S | Regulated Protein | [27] | |||
Zinc finger E-box-binding homeobox 1 | Regulated Protein | [13] | |||
References | |||||
REF 1 | MicroRNA down-regulated in human cholangiocarcinoma control cell cycle through multiple targets involved in the G1/S checkpoint. Hepatology. 2011 Dec;54(6):2089-98. | ||||
REF 2 | miR-494 suppresses tumor growth of epithelial ovarian carcinoma by targeting IGF1R. Tumour Biol. 2016 Jun;37(6):7767-76. | ||||
REF 3 | The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66. | ||||
REF 4 | MicroRNA-494-3p targets CXCR4 to suppress the proliferation, invasion, and migration of prostate cancer. Prostate. 2014 May;74(7):756-67. | ||||
REF 5 | MicroRNA-665 is involved in the regulation of the expression of the cardioprotective cannabinoid receptor CB2 in patients with severe heart failure. Biochem Biophys Res Commun. 2014 Sep 5;451(4):516-21. | ||||
REF 6 | Regulation of cystic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in F508 cystic fibrosis airway epithelium. J Immunol. 2013 Apr 1;190(7):3354-62. | ||||
REF 7 | miR-494-3p Regulates Cellular Proliferation, Invasion, Migration, and Apoptosis by PTEN/AKT Signaling in Human Glioblastoma Cells. Cell Mol Neurobiol. 2015 Jul;35(5):679-87. | ||||
REF 8 | Targeting survivin using a combination of miR 94 and survivin shRNA has synergistic effects on the suppression of prostate cancer growth. Mol Med Rep. 2016 Feb;13(2):1602-10. | ||||
REF 9 | Irradiation-induced angiogenesis is associated with an MMP-9-miR-494-syndecan-1 regulatory loop in medulloblastoma cells. Oncogene. 2014 Apr 10;33(15):1922-33. | ||||
REF 10 | The role of microRNA-27a/b and microRNA-494 in estrogen-mediated downregulation of tissue factor pathway inhibitor . J Thromb Haemost. 2016 Jun;14(6):1226-37. | ||||
REF 11 | Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98. | ||||
REF 12 | miR-494 acts as an anti-oncogene in gastric carcinoma by targeting c-myc. J Gastroenterol Hepatol. 2014;29(7):1427-34. | ||||
REF 13 | MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707. | ||||
REF 14 | MicroRNA-494 reduces ATF3 expression and promotes AKI. J Am Soc Nephrol. 2012 Dec;23(12):2012-23. | ||||
REF 15 | MicroRNA-494 plays a role in fiber type-specific skeletal myogenesis in human induced pluripotent stem cells. Biochem Biophys Res Commun. 2015 Dec 4-11;468(1-2):208-13. | ||||
REF 16 | Expression and rhythmic modulation of circulating microRNAs targeting the clock gene Bmal1 in mice.PLoS One. 2011;6(7):e22586. | ||||
REF 17 | Cinobufacin suppresses cell proliferation via miR-494 in BGC- 823 gastric cancer cells.Asian Pac J Cancer Prev. 2014;15(3):1241-5. | ||||
REF 18 | MiR-494 is regulated by ERK1/2 and modulates TRAIL-induced apoptosis in non-small-cell lung cancer through BIM down-regulation.Proc Natl Acad Sci U S A. 2012 Oct 9;109(41):16570-5. | ||||
REF 19 | Translational repression of SLC26A3 by miR-494 in intestinal epithelial cells.Am J Physiol Gastrointest Liver Physiol. 2014 Jan;306(2):G123-31. | ||||
REF 20 | MicroRNA-494 within an oncogenic microRNA megacluster regulates G1/S transition in liver tumorigenesis through suppression of mutated in colorectal cancer.Hepatology. 2014 Jan;59(1):202-15. | ||||
REF 21 | MicroRNA-494 regulates mitochondrial biogenesis in skeletal muscle through mitochondrial transcription factor A and Forkhead box j3.Am J Physiol Endocrinol Metab. 2012 Dec 15;303(12):E1419-27. | ||||
REF 22 | Identification of miR-494 direct targets involved in senescence of human diploid fibroblasts.FASEB J. 2014 Aug;28(8):3720-33. | ||||
REF 23 | miR-494 represses HOXA10 expression and inhibits cell proliferation in oral cancer.Oral Oncol. 2015 Feb;51(2):151-7. | ||||
REF 24 | MIR494 reduces renal cancer cell survival coinciding with increased lipid droplets and mitochondrial changes.BMC Cancer. 2016 Jan 21;16:33. | ||||
REF 25 | Ionizing radiation-inducible miR-494 promotes glioma cell invasion through EGFR stabilization by targeting p190B rhoGAP.Biochim Biophys Acta. 2014 Mar;1843(3):508-16. | ||||
REF 26 | Epigenetic regulation of steroid inactivating UDP-glucuronosyltransferases by microRNAs in prostate cancer.J Steroid Biochem Mol Biol. 2016 Jan;155(Pt A):85-93. | ||||
REF 27 | Micro-ribonucleic Acid 494 regulation of protein S expression.J Thromb Haemost. 2013 Aug;11(8):1547-55. | ||||
REF 28 | MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.