Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T80042 Target Info
Target Name Telomeric repeat-binding factor 1 (TERF1)
Synonyms Telomeric protein Pin2/TRF1; TTAGGG repeat-binding factor 1; TRF1; TRF; TRBF1; PIN2; NIMA-interacting protein 2
Target Type Literature-reported Target
Gene Name TERF1
UniProt ID
P54274
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism Transient transfection of HeLa cells with the miR-155 expression vector resulted in reduced TERF1 protein levels indicating miR-155 is a novel regulator of TERF1 expression in human cells. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Immunohistochemistry [1]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
References  Top
REF 1 miR-155 drives telomere fragility in human breast cancer by targeting TRF1. Cancer Res. 2014 Aug 1;74(15):4145-56.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.