Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T82146 |
Target Info
|
Target Name |
Retinoic acid receptor gamma (RARG) |
Synonyms |
RAR-gamma; Nuclear receptor subfamily 1 group B member 3; NR1B3 |
Target Type |
Successful Target |
Gene Name |
RARG |
Biochemical Class |
Nuclear hormone receptor |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-182-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuuggcaaugguagaacucacacu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-182-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target RARG. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34c-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcaguguaguuagcugauugc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclin-dependent kinase 4 (CDK4)
|
Target Info
|
|
References |
Top |
REF 1 |
Alterations in microRNA expression in stress-induced cellular senescence. Mech Ageing Dev. 2009 Nov-Dec;130(11-12):731-41.
|
REF 2 |
MIR-34c regulates mouse embryonic stem cells differentiation into male germ-like cells through RARg. Cell Biochem Funct. 2012 Dec;30(8):623-32.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.