Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T85328 |
Target Info
|
| Target Name |
Protein tyrosine phosphatase IVA 1 (PRL-1) |
| Synonyms |
Protein-tyrosine phosphatase of regenerating liver 1; Protein-tyrosine phosphatase 4a1; Protein tyrosine phosphatase type IVA 1; PTPCAAX1; PTP(CAAXI); PRL1 |
| Target Type |
Literature-reported Target |
| Gene Name |
PTP4A1 |
| Biochemical Class |
Phosphoric monoester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-339-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucccuguccuccaggagcucacg
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Beta-secretase 1 (BACE1)
|
Target Info
|
|
|
Protein tyrosine phosphatase IVA 1 (PRL-1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-944 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aaauuauuguacaucggaugag
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-944 binds the 3'UTR of PTP4A1 gene. |
[2] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Protein tyrosine phosphatase IVA 1 (PRL-1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-339-5p regulates the growth, colony formation and metastasis of colorectal cancer cells by targeting PRL-1. PLoS One. 2013 May 16;8(5):e63142.
|
| REF 2 |
Suppression of cell migration is promoted by miR-944 through targeting of SIAH1 and PTP4A1 in breast cancer cells. BMC Cancer. 2016 Jul 4;16:379.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
