Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T87350 |
Target Info
|
| Target Name |
Platelet-derived growth factor B (PDGFB) |
| Synonyms |
SIS; Protooncogene cSis; Proto-oncogene c-Sis; Plateletderived growth factor subunit B; Plateletderived growth factor beta polypeptide; Plateletderived growth factor B chain; Platelet-derived growth factor subunit B; Platelet-derived growth factor beta polypeptide; Platelet-derived growth factor B chain; PDGF2; PDGF-2; PDGF subunit B; Becaplermin |
| Target Type |
Clinical trial Target |
| Gene Name |
PDGFB |
| Biochemical Class |
Growth factor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-146b-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gcccuguggacucaguucuggu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Induction of miR-146b is specific to PDGFB. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
ELISA; Immunoblot |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
IL-1 receptor-associated kinase 1 (IRAK1)
|
Target Info
|
|
|
Platelet-derived growth factor B (PDGFB)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-184 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggacggagaacugauaagggu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[3] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Platelet-derived growth factor B (PDGFB)
|
Target Info
|
|
| References |
Top |
| REF 1 |
PDGF induced microRNA alterations in cancer cells. Nucleic Acids Res. 2011 May;39(10):4035-47.
|
| REF 2 |
The regulatory roles of microRNA-146b-5p and its target platelet-derived growth factor receptor (PDGFRA) in erythropoiesis and megakaryocytopoiesis. J Biol Chem. 2014 Aug 15;289(33):22600-13.
|
| REF 3 |
miR-184 exhibits angiostatic properties via regulation of Akt and VEGF signaling pathways. FASEB J. 2017 Jan;31(1):256-265.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
