Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T88322 |
Target Info
|
| Target Name |
Facilitates chromatin transcription complex (FACT) |
| Synonyms |
hSSRP1; T160; Structure-specific recognition protein 1; Recombination signal sequence recognition protein 1; Facilitates chromatin transcription complex subunit SSRP1; Facilitates chromatin transcription complex 80 kDa subunit; FACTp80; FACT80; FACT complex subunit SSRP1; FACT 80 kDa subunit; Chromatin-specific transcription elongation factor 80 kDa subunit |
| Target Type |
Clinical trial Target |
| Gene Name |
SSRP1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-497-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cagcagcacacugugguuugu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
PAR-CLIP |
[2] |
| Representative Target(s) Regulated by This miRNA |
Angiomotin (AMOT)
|
Target Info
|
|
|
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-211-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucccuuugucauccuucgccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
SSRP1 is generally down-regulated by miR-211 indirectly drives the expression of miR-211. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Calcium-activated potassium channel KCa1.1 (KCNMA1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
SSRP1 Contributes to the Malignancy of Hepatocellular Carcinoma and Is Negatively Regulated by miR-497. Mol Ther. 2016 May;24(5):903-14.
|
| REF 2 |
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
|
| REF 3 |
New target genes of MITF-induced microRNA-211 contribute to melanoma cell invasion. PLoS One. 2013 Sep 5;8(9):e73473.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
