Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T90961 Target Info
Target Name BMP-2-inducible protein kinase (BMP2K)
Synonyms HRIHFB2017; BIKe
Target Type Literature-reported Target
Gene Name BMP2K
Biochemical Class Kinase
UniProt ID
Q9NSY1
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-1228-3p miRNA Info
miRNA Mature AC
MIMAT0005583
Sequence ucacaccugccucgcccccc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA BMP-2-inducible protein kinase (BMP2K) Target Info
BMP2K_HUMAN
Casein kinase II alpha prime (CSNK2A2) Target Info
CSK22_HUMAN
References  Top
REF 1 Vitamin D activation of functionally distinct regulatory miRNAs in primary human osteoblasts. J Bone Miner Res. 2013 Jun;28(6):1478-88.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.