Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T94532 |
Target Info
|
| Target Name |
Regenerating islet-derived protein IV (REG4) |
| Synonyms |
Regenerating islet-derived protein 4; Regenerating islet-derived family, member 4; Reg IV; RELP; REGIV; REG-like protein; REG-4; Gastrointestinal secretory protein GISP; Gastrointestinal secretory protein; GISP |
| Target Type |
Literature-reported Target |
| Gene Name |
REG4 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-363-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aauugcacgguauccaucugua
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunoblot; Luciferase Reporter Assay; qRT-PCR |
[1] |
| 2 |
PAR-CLIP |
[2] |
| Representative Target(s) Regulated by This miRNA |
Caspase-3 (CASP3)
|
Target Info
|
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
REG4 is a transcriptional target of GATA6 and is essential for colorectal tumorigenesis. Sci Rep. 2015 Sep 21;5:14291.
|
| REF 2 |
MicroRNA target site identification by integrating sequence and binding information. Nat Methods. 2013 Jul;10(7):630-3.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
