Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T95736 |
Target Info
|
| Target Name |
Serine/threonine-protein kinase NIK (MAP3K14) |
| Synonyms |
NIK; NF-kappa-beta-inducing kinase; Mitogen-activated protein kinase kinase kinase 14; HsNIK |
| Target Type |
Literature-reported Target |
| Gene Name |
MAP3K14 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuaaugcuaaucgugauagggguu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Reporter Assay |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggcagugucuuagcugguugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
MAP3K14/hsa-miR-34a pair is involved in pathogenesis and maintenance of hypertension. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR |
[3] |
| Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
|
Androgen receptor (AR)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
|
| REF 2 |
miR-155 induced transcriptome changes in the MCF-7 breast cancer cell line leads to enhanced mitogen activated protein kinase signaling. Genes Cancer. 2014 Sep;5(9-10):353-64.
|
| REF 3 |
Differential expression of microRNA in endothelial cells incubated with serum of hypertension patients with blood-stasis syndrome. Chin J Integr Med. 2015 Nov;21(11):817-22.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
