The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-126-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucguaccgugaguaauaaugcg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-126 inhibits the tumor cell proliferation though PI3K-AKT pathway in NSCLC. |
[2] |
Evidence Score (E-score) |
4 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
3 |
Microarray; qRT-PCR; Western Blot; SILAC |
[3] |
4 |
qRT-PCR; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Adrenomedullin (ADM)
|
Target Info
|
|
Angiopoietin 1 receptor (TEK)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-27a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucacaguggcuaaguuccgc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[5] |
2 |
Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-127-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucggauccgucugagcuuggcu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Downregulation of miR-127 resulted in the increased mRNA level of PIK3CG. |
[7] |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA |
[7] |
2 |
RT-PCR |
[7] |
Representative Target(s) Regulated by This miRNA |
Matrix metalloproteinase-13 (MMP-13)
|
Target Info
|
|
O-6-methylguanine-DNA-alkyltransferase (MGMT)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-10a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uacccuguagauccgaauuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-10a as a novel regulator of PI3K signaling and demonstrated that miR-10a inhibits ASM cell proliferation by sup- pressing PI3K signaling through direct targeting of the central PI3K pathway component, PIK3CG. |
[8] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[8] |
Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[9] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-196b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagguaguuuccuguuguuggg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Upregulation of miR-196b promotes the proliferation and invasion ability of gastric cancer cells by regulating the PI3K/AKT/mTOR pathway. |
[10] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[10] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcagugucuuagcugguugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[11] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Androgen receptor (AR)
|
Target Info
|
|