Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T95961 | Target Info | |||
| Target Name | Interleukin 13 receptor alpha-1 (IL13RA1) | ||||
| Synonyms | Interleukin-13 receptor subunit alpha-1; IL13RA; IL13R; IL-13RA1; IL-13RA-1; IL-13R-alpha-1; IL-13R subunit alpha-1; IL-13R alpha-1 chain; IL-13 receptor subunit alpha-1; Cancer/testis antigen 19; CT19; CD213a1 antigen; CD213a1 | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | IL13RA1 | ||||
| Biochemical Class | Cytokine receptor | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-143-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugagaugaagcacuguagcuc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | IL13RA1 mRNA expression was downregulated in miR-143 transfected cells. | [2] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [1] | |||
| 2 | qRT-PCR; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
| Connective tissue growth factor (CTGF) | Target Info | ||||
| miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uuaaugcuaaucgugauagggguu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-155 directly targets IL13RA1. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [3] | |||
| Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
| Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MicroRNA-143 inhibits IL-13-induced dysregulation of the epidermal barrier-related proteins in skin keratinocytes via targeting to IL-13R1. Mol Cell Biochem. 2016 May;416(1-2):63-70. | ||||
| REF 2 | MicroRNA-143 downregulates interleukin-13 receptor alpha1 in human mast cells. Int J Mol Sci. 2013 Aug 19;14(8):16958-69. | ||||
| REF 3 | The interleukin 13 (IL-13) pathway in human macrophages is modulated by microRNA-155 via direct targeting of interleukin 13 receptor alpha1 (IL13Ralpha1). J Biol Chem. 2011 Jan 21;286(3):1786-94. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.