The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-100-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aacccguagauccgaacuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Luciferase activity of the 3' UTR of FKBP5 was reduced after transfection of miR-100 a; when the predicted target sites were mutated, the luciferase activity was unaffected. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
Bone morphogenetic protein receptor (BMPR2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-99a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aacccguagauccgaucuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Luciferase activity of the 3'UTR of FKBP5 was reduced after transfection of miR-99a; when the target site were mutated, the luciferase activity was unaffected. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Endothelial plasminogen activator inhibitor (SERPINE1)
|
Target Info
|
|
Fibroblast growth factor receptor 3 (FGFR3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-511-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugucuuuugcucugcaguca
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-511 suppresses FKBP5 mRNA and protein levels bounding directly to the 3'UTR of FKBP5. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
FK506-binding protein 5 (FKBP5)
|
Target Info
|
|
Liver organic anion transporter 1 (SLCO1B1)
|
Target Info
|
|