Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T98337 Target Info
Target Name FK506-binding protein 5 (FKBP5)
Synonyms Peptidyl-prolyl cis-trans isomerase FKBP5; PPIase FKBP5; HSP90-binding immunophilin; FKBP54; FKBP51; FKBP-51; FKBP-5; FF1 antigen; Androgen-regulated protein 6; AIG6; 54 kDa progesterone receptor-associated immunophilin; 51 kDa FKBP; 51 kDa FK506-binding protein
Target Type Literature-reported Target
Gene Name FKBP5
Biochemical Class Cis-trans-isomerase
UniProt ID
Q13451
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity of the 3' UTR of FKBP5 was reduced after transfection of miR-100 a; when the predicted target sites were mutated, the luciferase activity was unaffected. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-99a-5p miRNA Info
miRNA Mature AC
MIMAT0000097
Sequence aacccguagauccgaucuugug
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity of the 3'UTR of FKBP5 was reduced after transfection of miR-99a; when the target site were mutated, the luciferase activity was unaffected. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
miRNA Mature ID hsa-miR-511-5p miRNA Info
miRNA Mature AC
MIMAT0002808
Sequence gugucuuuugcucugcaguca
miRNA Species Homo sapiens
Regulation Mechanism miR-511 suppresses FKBP5 mRNA and protein levels bounding directly to the 3'UTR of FKBP5. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA FK506-binding protein 5 (FKBP5) Target Info
FKBP5_HUMAN
Liver organic anion transporter 1 (SLCO1B1) Target Info
SO1B1_HUMAN
References  Top
REF 1 MicroRNA-100/99a, deregulated in acute lymphoblastic leukaemia, suppress proliferation and promote apoptosis by regulating the FKBP51 and IGF1R/mTOR signalling pathways. Br J Cancer. 2013 Oct 15;109(8):2189-98.
REF 2 Multiple Roles of MicroRNA-100 in Human Cancer and its Therapeutic Potential. Cell Physiol Biochem. 2015;37(6):2143-59.
REF 3 MicroRNA-511 Binds to FKBP5 mRNA, Which Encodes a Chaperone Protein, and Regulates Neuronal Differentiation. J Biol Chem. 2016 Aug 19;291(34):17897-906.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.