Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T98642 |
Target Info
|
| Target Name |
PDZ binding kinase (PBK) |
| Synonyms |
TOPK; T-LAK cell-originated protein kinase; Spermatogenesis-related protein kinase; SPK protein; PDZ-binding kinase; Nori-3; MAPKK-like protein kinase; Lymphokine-activated killer T-cell-originated protein kinase; Cancer/testis antigen 84; CT84 |
| Target Type |
Literature-reported Target |
| Gene Name |
PBK |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-216b-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aaaucucugcaggcaaauguga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-216b could down-regulate PBK levels by binding to the 3'untranslated region (3'UTR) of PBK. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Beclin-1 (BECN1)
|
Target Info
|
|
|
Casein kinase II alpha (CSNK2A1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-216b promotes cell growth and enhances chemosensitivity of colorectal cancer by suppressing PDZ-binding kinase. Biochem Biophys Res Commun. 2017 Jun 24;488(2):247-252.
|
| REF 2 |
MicroRNA-216b-3p inhibits lung adenocarcinoma cell growth via regulating PDZ binding kinase/T-LAK-cell-originated protein kinase. Exp Ther Med. 2018 Jun;15(6):4822-4828.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
