miRNA General Information
miRNA Mature ID hsa-let-7a-5p
miRNA Stemloop AC MI0000060 | MI0000061 | MI0000062
miRNA Stemloop ID hsa-let-7a-1 | hsa-let-7a-2 | hsa-let-7a-3
Sequence ugagguaguagguuguauaguu
TTD Target(s) Regulated by This miRNA Caspase-3 (CASP3) Clinical trial Target Target Info [1]
GTPase NRas (NRAS) Clinical trial Target Target Info [2]
GTPase HRas (HRAS) Literature-reported Target Target Info [3]
Integrin beta-3 (ITGB3) Literature-reported Target Target Info [4]
High mobility group protein HMGI-C (HMGA2) Literature-reported Target Target Info [5]
Protein(s) Regulated by This miRNA AMME syndrome candidate gene 1 protein Regulated Protein [6]
DIS3-like exonuclease 2 Regulated Protein [7]
E3 ubiquitin-protein ligase TRIM71 Regulated Protein [8]
E3 ubiquitin-protein ligase UHRF1 Regulated Protein [9]
E3 ubiquitin-protein ligase UHRF2 Regulated Protein [10]
Early growth response protein 3 Regulated Protein [6]
G1/S-specific cyclin-D2 Regulated Protein [11]
G1/S-specific cyclin-D2 Regulated Protein [12]
Hepatocyte nuclear factor 3-alpha Regulated Protein [8]
Heterogeneous nuclear ribonucleoprotein D-like Regulated Protein [6]
Homeobox protein Meis1 Regulated Protein [6]
Hyaluronan synthase 2 Regulated Protein [13]
Insulin-like growth factor 2 mRNA-binding protein 1 Regulated Protein [14]
Merlin Regulated Protein [15]
mRNA decay activator protein ZFP36L1 Regulated Protein [6]
Neurofilament medium polypeptide Regulated Protein [6]
NF-kappa-B inhibitor-interacting Ras-like protein 2 Regulated Protein [16]
PR domain zinc finger protein 1 Regulated Protein [17]
Protein argonaute-1 Regulated Protein [18]
Protein argonaute-4 Regulated Protein [19]
Protein lin-28 homolog A Regulated Protein [20]
Protein lin-28 homolog B Regulated Protein [21]
Proto-oncogene Wnt-1 Regulated Protein [22]
Ras-related protein Rab-40C Regulated Protein [23]
Ribonucleoprotein PTB-binding 2 Regulated Protein [24]
RNA-binding protein EWS Regulated Protein [25]
Sodium-dependent phosphate transporter 1 Regulated Protein [6]
Transforming growth factor beta receptor type 3 Regulated Protein [26]
Transmembrane emp24 domain-containing protein 7 Regulated Protein [10]
Ubiquitin carboxyl-terminal hydrolase 35 Regulated Protein [27]
Ubiquitin-conjugating enzyme E2 R1 Regulated Protein [14]
References
REF 1 Let-7a microRNA suppresses therapeutics-induced cancer cell death by targeting caspase-3. Apoptosis. 2008 Oct;13(10):1215-22.
REF 2 RAS is regulated by the let-7 microRNA family. Cell. 2005 Mar 11;120(5):635-47.
REF 3 Lin28-let7 modulates radiosensitivity of human cancer cells with activation of K-Ras. Int J Radiat Oncol Biol Phys. 2010 Jan 1;76(1):5-8.
REF 4 Integrin beta 3 expression is regulated by let-7a miRNA in malignant melanoma. Oncogene. 2008 Nov 6;27(52):6698-706.
REF 5 High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5.
REF 6 MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007 Oct 15;67(20):9762-70.
REF 7 Mammalian DIS3L2 exoribonuclease targets the uridylated precursors of let-7 miRNAs.RNA. 2013 Dec;19(12):1632-8.
REF 8 Human TRIM71 and its nematode homologue are targets of let-7 microRNA and its zebrafish orthologue is essential for development.Mol Biol Evol. 2007 Nov;24(11):2525-34.
REF 9 Promoter hypermethylation of let-7a-3 is relevant to its down-expression in diabetic nephropathy by targeting UHRF1.Gene. 2015 Oct 1;570(1):57-63.
REF 10 Let-7a elevates p21(WAF1) levels by targeting of NIRF and suppresses the growth of A549 lung cancer cells.FEBS Lett. 2009 Nov 3;583(21):3501-7.
REF 11 MicroRNA let-7a inhibits proliferation of human prostate cancer cells in vitro and in vivo by targeting E2F2 and CCND2.PLoS One. 2010 Apr 14;5(4):e10147.
REF 12 c-Myc Represses Tumor-Suppressive microRNAs, let-7a, miR-16 and miR-29b, and Induces Cyclin D2-Mediated Cell Proliferation in Ewing's Sarcoma Cell Line.PLoS One. 2015 Sep 22;10(9):e0138560.
REF 13 An anti-let-7 sponge decoys and decays endogenous let-7 functions.Cell Cycle. 2012 Aug 15;11(16):3097-108.
REF 14 IMP-1 displays cross-talk with K-Ras and modulates colon cancer cell survival through the novel proapoptotic protein CYFIP2. Cancer Res. 2011 Mar 15;71(6):2172-82.
REF 15 The MicroRNA let-7a modulates interleukin-6-dependent STAT-3 survival signaling in malignant human cholangiocytes.J Biol Chem. 2007 Mar 16;282(11):8256-64.
REF 16 Estradiol suppresses NF-kappa B activation through coordinated regulation of let-7a and miR-125b in primary human macrophages.J Immunol. 2010 May 1;184(9):5029-37.
REF 17 MicroRNA-mediated down-regulation of PRDM1/Blimp-1 in Hodgkin/Reed-Sternberg cells: a potential pathogenetic lesion in Hodgkin lymphomas.Am J Pathol. 2008 Jul;173(1):242-52.
REF 18 Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67.
REF 19 Computational prediction and experimental validation of evolutionarily conserved microRNA target genes in bilaterian animals. BMC Genomics. 2010 Feb 9;11:101.
REF 20 MicroRNAs direct rapid deadenylation of mRNA.Proc Natl Acad Sci U S A. 2006 Mar 14;103(11):4034-9.
REF 21 Merlin/NF2-Lin28B-let-7 Is a Tumor-Suppressive Pathway that Is Cell-Density Dependent and Hippo Independent.Cell Rep. 2016 Mar 29;14(12):2950-61.
REF 22 Let-7 inhibits self-renewal of hepatocellular cancer stem-like cells through regulating the epithelial-mesenchymal transition and the Wnt signaling pathway.BMC Cancer. 2016 Nov 8;16(1):863.
REF 23 Low-level expression of let-7a in gastric cancer and its involvement in tumorigenesis by targeting RAB40C.Carcinogenesis. 2011 May;32(5):713-22.
REF 24 Identification of human microRNA targets from isolated argonaute protein complexes.RNA Biol. 2007 Jun;4(2):76-84.
REF 25 Let-7a is a direct EWS-FLI-1 target implicated in Ewing's sarcoma development.PLoS One. 2011;6(8):e23592.
REF 26 H19 long noncoding RNA alters trophoblast cell migration and invasion by regulating TR3 in placentae with fetal growth restriction.Oncotarget. 2016 Jun 21;7(25):38398-38407.
REF 27 USP35 activated by miR let-7a inhibits cell proliferation and NF-B activation through stabilization of ABIN-2.Oncotarget. 2015 Sep 29;6(29):27891-906.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.