miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-let-7a-5p | ||||
miRNA Stemloop AC | MI0000060 | MI0000061 | MI0000062 | ||||
miRNA Stemloop ID | hsa-let-7a-1 | hsa-let-7a-2 | hsa-let-7a-3 | ||||
Sequence | ugagguaguagguuguauaguu | ||||
TTD Target(s) Regulated by This miRNA | Caspase-3 (CASP3) | Clinical trial Target | Target Info | [1] | |
GTPase NRas (NRAS) | Clinical trial Target | Target Info | [2] | ||
GTPase HRas (HRAS) | Literature-reported Target | Target Info | [3] | ||
Integrin beta-3 (ITGB3) | Literature-reported Target | Target Info | [4] | ||
High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [5] | ||
Protein(s) Regulated by This miRNA | AMME syndrome candidate gene 1 protein | Regulated Protein | [6] | ||
DIS3-like exonuclease 2 | Regulated Protein | [7] | |||
E3 ubiquitin-protein ligase TRIM71 | Regulated Protein | [8] | |||
E3 ubiquitin-protein ligase UHRF1 | Regulated Protein | [9] | |||
E3 ubiquitin-protein ligase UHRF2 | Regulated Protein | [10] | |||
Early growth response protein 3 | Regulated Protein | [6] | |||
G1/S-specific cyclin-D2 | Regulated Protein | [11] | |||
G1/S-specific cyclin-D2 | Regulated Protein | [12] | |||
Hepatocyte nuclear factor 3-alpha | Regulated Protein | [8] | |||
Heterogeneous nuclear ribonucleoprotein D-like | Regulated Protein | [6] | |||
Homeobox protein Meis1 | Regulated Protein | [6] | |||
Hyaluronan synthase 2 | Regulated Protein | [13] | |||
Insulin-like growth factor 2 mRNA-binding protein 1 | Regulated Protein | [14] | |||
Merlin | Regulated Protein | [15] | |||
mRNA decay activator protein ZFP36L1 | Regulated Protein | [6] | |||
Neurofilament medium polypeptide | Regulated Protein | [6] | |||
NF-kappa-B inhibitor-interacting Ras-like protein 2 | Regulated Protein | [16] | |||
PR domain zinc finger protein 1 | Regulated Protein | [17] | |||
Protein argonaute-1 | Regulated Protein | [18] | |||
Protein argonaute-4 | Regulated Protein | [19] | |||
Protein lin-28 homolog A | Regulated Protein | [20] | |||
Protein lin-28 homolog B | Regulated Protein | [21] | |||
Proto-oncogene Wnt-1 | Regulated Protein | [22] | |||
Ras-related protein Rab-40C | Regulated Protein | [23] | |||
Ribonucleoprotein PTB-binding 2 | Regulated Protein | [24] | |||
RNA-binding protein EWS | Regulated Protein | [25] | |||
Sodium-dependent phosphate transporter 1 | Regulated Protein | [6] | |||
Transforming growth factor beta receptor type 3 | Regulated Protein | [26] | |||
Transmembrane emp24 domain-containing protein 7 | Regulated Protein | [10] | |||
Ubiquitin carboxyl-terminal hydrolase 35 | Regulated Protein | [27] | |||
Ubiquitin-conjugating enzyme E2 R1 | Regulated Protein | [14] | |||
References | |||||
REF 1 | Let-7a microRNA suppresses therapeutics-induced cancer cell death by targeting caspase-3. Apoptosis. 2008 Oct;13(10):1215-22. | ||||
REF 2 | RAS is regulated by the let-7 microRNA family. Cell. 2005 Mar 11;120(5):635-47. | ||||
REF 3 | Lin28-let7 modulates radiosensitivity of human cancer cells with activation of K-Ras. Int J Radiat Oncol Biol Phys. 2010 Jan 1;76(1):5-8. | ||||
REF 4 | Integrin beta 3 expression is regulated by let-7a miRNA in malignant melanoma. Oncogene. 2008 Nov 6;27(52):6698-706. | ||||
REF 5 | High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5. | ||||
REF 6 | MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007 Oct 15;67(20):9762-70. | ||||
REF 7 | Mammalian DIS3L2 exoribonuclease targets the uridylated precursors of let-7 miRNAs.RNA. 2013 Dec;19(12):1632-8. | ||||
REF 8 | Human TRIM71 and its nematode homologue are targets of let-7 microRNA and its zebrafish orthologue is essential for development.Mol Biol Evol. 2007 Nov;24(11):2525-34. | ||||
REF 9 | Promoter hypermethylation of let-7a-3 is relevant to its down-expression in diabetic nephropathy by targeting UHRF1.Gene. 2015 Oct 1;570(1):57-63. | ||||
REF 10 | Let-7a elevates p21(WAF1) levels by targeting of NIRF and suppresses the growth of A549 lung cancer cells.FEBS Lett. 2009 Nov 3;583(21):3501-7. | ||||
REF 11 | MicroRNA let-7a inhibits proliferation of human prostate cancer cells in vitro and in vivo by targeting E2F2 and CCND2.PLoS One. 2010 Apr 14;5(4):e10147. | ||||
REF 12 | c-Myc Represses Tumor-Suppressive microRNAs, let-7a, miR-16 and miR-29b, and Induces Cyclin D2-Mediated Cell Proliferation in Ewing's Sarcoma Cell Line.PLoS One. 2015 Sep 22;10(9):e0138560. | ||||
REF 13 | An anti-let-7 sponge decoys and decays endogenous let-7 functions.Cell Cycle. 2012 Aug 15;11(16):3097-108. | ||||
REF 14 | IMP-1 displays cross-talk with K-Ras and modulates colon cancer cell survival through the novel proapoptotic protein CYFIP2. Cancer Res. 2011 Mar 15;71(6):2172-82. | ||||
REF 15 | The MicroRNA let-7a modulates interleukin-6-dependent STAT-3 survival signaling in malignant human cholangiocytes.J Biol Chem. 2007 Mar 16;282(11):8256-64. | ||||
REF 16 | Estradiol suppresses NF-kappa B activation through coordinated regulation of let-7a and miR-125b in primary human macrophages.J Immunol. 2010 May 1;184(9):5029-37. | ||||
REF 17 | MicroRNA-mediated down-regulation of PRDM1/Blimp-1 in Hodgkin/Reed-Sternberg cells: a potential pathogenetic lesion in Hodgkin lymphomas.Am J Pathol. 2008 Jul;173(1):242-52. | ||||
REF 18 | Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67. | ||||
REF 19 | Computational prediction and experimental validation of evolutionarily conserved microRNA target genes in bilaterian animals. BMC Genomics. 2010 Feb 9;11:101. | ||||
REF 20 | MicroRNAs direct rapid deadenylation of mRNA.Proc Natl Acad Sci U S A. 2006 Mar 14;103(11):4034-9. | ||||
REF 21 | Merlin/NF2-Lin28B-let-7 Is a Tumor-Suppressive Pathway that Is Cell-Density Dependent and Hippo Independent.Cell Rep. 2016 Mar 29;14(12):2950-61. | ||||
REF 22 | Let-7 inhibits self-renewal of hepatocellular cancer stem-like cells through regulating the epithelial-mesenchymal transition and the Wnt signaling pathway.BMC Cancer. 2016 Nov 8;16(1):863. | ||||
REF 23 | Low-level expression of let-7a in gastric cancer and its involvement in tumorigenesis by targeting RAB40C.Carcinogenesis. 2011 May;32(5):713-22. | ||||
REF 24 | Identification of human microRNA targets from isolated argonaute protein complexes.RNA Biol. 2007 Jun;4(2):76-84. | ||||
REF 25 | Let-7a is a direct EWS-FLI-1 target implicated in Ewing's sarcoma development.PLoS One. 2011;6(8):e23592. | ||||
REF 26 | H19 long noncoding RNA alters trophoblast cell migration and invasion by regulating TR3 in placentae with fetal growth restriction.Oncotarget. 2016 Jun 21;7(25):38398-38407. | ||||
REF 27 | USP35 activated by miR let-7a inhibits cell proliferation and NF-B activation through stabilization of ABIN-2.Oncotarget. 2015 Sep 29;6(29):27891-906. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.