miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-302b-3p | ||||
miRNA Stemloop AC | MI0000772 | ||||
miRNA Stemloop ID | hsa-mir-302b | ||||
Sequence | uaagugcuuccauguuuuaguag | ||||
TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
Erbb4 tyrosine kinase receptor (Erbb-4) | Successful Target | Target Info | [2] | ||
Dihydrothymine dehydrogenase (DPYD) | Successful Target | Target Info | [3] | ||
RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [4] | ||
Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [5] | ||
Histone deacetylase 4 (HDAC4) | Clinical trial Target | Target Info | [6] | ||
Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [3] | ||
MAPK/ERK kinase kinase 1 (MAP3K1) | Clinical trial Target | Target Info | [7] | ||
TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [8] | ||
E2F transcription factor 1 (E2F1) | Clinical trial Target | Target Info | [9] | ||
RAC-beta serine/threonine-protein kinase (AKT2) | Literature-reported Target | Target Info | [10] | ||
Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [11] | ||
Protein(s) Regulated by This miRNA | G1/S-specific cyclin-D2 | Regulated Protein | [12] | ||
Nuclear factor 1 A-type | Regulated Protein | [13] | |||
Rho-related GTP-binding protein RhoC | Regulated Protein | [8] | |||
References | |||||
REF 1 | MicroRNA-302b suppresses cell proliferation by targeting EGFR in human hepatocellular carcinoma SMMC-7721 cells. BMC Cancer. 2013 Oct 2;13:448. | ||||
REF 2 | miR-302b is a potential molecular marker of esophageal squamous cell carcinoma and functions as a tumor suppressor by targeting ErbB4. J Exp Clin Cancer Res. 2014 Jan 19;33:10. | ||||
REF 3 | MicroRNA-302b Enhances the Sensitivity of Hepatocellular Carcinoma Cell Lines to 5-FU via Targeting Mcl-1 and DPYD. Int J Mol Sci. 2015 Oct 6;16(10):23668-82. | ||||
REF 4 | The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1. RNA. 2013 Jan;19(1):85-95. | ||||
REF 5 | miR-302b regulates cell cycles by targeting CDK2 via ERK signaling pathway in gastric cancer. Cancer Med. 2016 Sep;5(9):2302-13. | ||||
REF 6 | Increased sensitivity to chemotherapy induced by CpG-ODN treatment is mediated by microRNA modulation. PLoS One. 2013;8(3):e58849. | ||||
REF 7 | MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25. | ||||
REF 8 | Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nat Biotechnol. 2011 May;29(5):443-8. | ||||
REF 9 | miR-302b enhances breast cancer cell sensitivity to cisplatin by regulating E2F1 and the cellular DNA damage response. Oncotarget. 2016 Jan 5;7(1):786-97. | ||||
REF 10 | miRNA-302b suppresses human hepatocellular carcinoma by targeting AKT2. Mol Cancer Res. 2014 Feb;12(2):190-202. | ||||
REF 11 | Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30. | ||||
REF 12 | miR-302b maintains "stemness" of human embryonal carcinoma cells by post-transcriptional regulation of Cyclin D2 expression.Biochem Biophys Res Commun. 2008 Dec 12;377(2):434-440. | ||||
REF 13 | The microRNA-302b-inhibited insulin-like growth factor-binding protein 2 signaling pathway induces glioma cell apoptosis by targeting nuclear factor IA.PLoS One. 2017 Mar 21;12(3):e0173890. | ||||
REF 14 | Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nat Biotechnol. 2011 May;29(5):443-8. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.