miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-449a | ||||
miRNA Stemloop AC | MI0001648 | ||||
miRNA Stemloop ID | hsa-mir-449a | ||||
Sequence | uggcaguguauuguuagcuggu | ||||
TTD Target(s) Regulated by This miRNA | Histone deacetylase 1 (HDAC1) | Successful Target | Target Info | [1] | |
Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [2] | ||
Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [2] | ||
Proto-oncogene c-Met (MET) | Successful Target | Target Info | [3] | ||
Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [4] | ||
ERK activator kinase 1 (MEK1) | Clinical trial Target | Target Info | [5] | ||
NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [3] | ||
Mammalian disintegrin-metalloprotease (ADAM10) | Clinical trial Target | Target Info | [6] | ||
G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [7] | ||
Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [8] | ||
Histone deacetylase 8 (HDAC8) | Clinical trial Target | Target Info | [1] | ||
M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [2] | ||
Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [9] | ||
Hepatocyte nuclear factor 4-alpha (HNF4A) | Literature-reported Target | Target Info | [10] | ||
Proto-oncogene c-Fos (c-Fos) | Literature-reported Target | Target Info | [11] | ||
Geminin (GMNN) | Literature-reported Target | Target Info | [3] | ||
IP3 receptor isoform 1 (ITPR1) | Literature-reported Target | Target Info | [5] | ||
N-myc proto-oncogene protein (MYCN) | Literature-reported Target | Target Info | [12] | ||
G1/S-specific cyclin-E2 (CCNE2) | Literature-reported Target | Target Info | [3] | ||
Protein(s) Regulated by This miRNA | Calpain-6 | Regulated Protein | [13] | ||
Cyclic AMP-responsive element-binding protein 5 | Regulated Protein | [14] | |||
Cysteine-rich protein 2 | Regulated Protein | [15] | |||
Flotillin-2 | Regulated Protein | [16] | |||
Lymphoid enhancer-binding factor 1 | Regulated Protein | [17] | |||
Microfibril-associated glycoprotein 4 | Regulated Protein | [18] | |||
Myc-associated zinc finger protein | Regulated Protein | [19] | |||
Plakophilin-4 | Regulated Protein | [18] | |||
POU domain, class 2, transcription factor 1 | Regulated Protein | [13] | |||
Ras-related protein R-Ras | Regulated Protein | [20] | |||
tRNA-splicing endonuclease subunit Sen15 | Regulated Protein | [18] | |||
WNT1-inducible-signaling pathway protein 2 | Regulated Protein | [21] | |||
References | |||||
REF 1 | miR-449a targets HDAC-1 and induces growth arrest in prostate cancer. Oncogene. 2009 Apr 9;28(14):1714-24. | ||||
REF 2 | miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A. Genes Dev. 2009 Oct 15;23(20):2388-93. | ||||
REF 3 | miR-449 inhibits cell proliferation and is down-regulated in gastric cancer. Mol Cancer. 2011 Mar 18;10:29. | ||||
REF 4 | EVI1-mediated down regulation of MIR449A is essential for the survival of EVI1 positive leukaemic cells. Br J Haematol. 2011 Aug;154(3):337-48. | ||||
REF 5 | The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66. | ||||
REF 6 | miR-449a inhibits proliferation and invasion by regulating ADAM10 in hepatocellular carcinoma. Am J Transl Res. 2016 Jun 15;8(6):2609-19. | ||||
REF 7 | miR-449a causes Rb-dependent cell cycle arrest and senescence in prostate cancer cells. Oncotarget. 2010 Sep;1(5):349-58. | ||||
REF 8 | Hepatitis C virus mediated changes in miRNA-449a modulates inflammatory biomarker YKL40 through components of the NOTCH signaling pathway. PLoS One. 2012;7(11):e50826. | ||||
REF 9 | Rapid identification of regulatory microRNAs by miTRAP (miRNA trapping by RNA in vitro affinity purification). Nucleic Acids Res. 2014 Apr;42(8):e66. | ||||
REF 10 | The role of microRNAs in hepatocyte nuclear factor-4alpha expression and transactivation. Biochim Biophys Acta. 2013 May;1829(5):436-42. | ||||
REF 11 | MiR-449a suppresses the epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma by multiple targets. BMC Cancer. 2015 Oct 15;15:706. | ||||
REF 12 | MiR-449a Affects Epithelial Proliferation during the Pseudoglandular and Canalicular Phases of Avian and Mammal Lung Development. PLoS One. 2016 Feb 18;11(2):e0149425. | ||||
REF 13 | miR-449a promotes liver cancer cell apoptosis by downregulation of Calpain 6 and POU2F1.Oncotarget. 2016 Mar 22;7(12):13491-501. | ||||
REF 14 | Epigenetically regulated miR-449a enhances hepatitis B virus replication by targeting cAMP-responsive element binding protein 5 and modulating hepatocytes phenotype.Sci Rep. 2016 May 3;6:25389. | ||||
REF 15 | MiR-449a promotes breast cancer progression by targeting CRIP2.Oncotarget. 2016 Apr 5;7(14):18906-18. | ||||
REF 16 | miR-449a targets Flot2 and inhibits gastric cancer invasion by inhibiting TGF--mediated EMT.Diagn Pathol. 2015 Nov 14;10:202. | ||||
REF 17 | miR-449a regulates the chondrogenesis of human mesenchymal stem cells through direct targeting of lymphoid enhancer-binding factor-1.Stem Cells Dev. 2012 Dec 10;21(18):3298-308. | ||||
REF 18 | microRNA-449a functions as a tumor suppressor in neuroblastoma through inducing cell differentiation and cell cycle arrest. RNA Biol. 2015;12(5):538-54. | ||||
REF 19 | MiR-449a exerts tumor-suppressive functions in human glioblastoma by targeting Myc-associated zinc-finger protein.Mol Oncol. 2015 Mar;9(3):640-56. | ||||
REF 20 | miR-34/449 control apical actin network formation during multiciliogenesis through small GTPase pathways.Nat Commun. 2015 Sep 18;6:8386. | ||||
REF 21 | MicroRNA signature of primary pigmented nodular adrenocortical disease: clinical correlations and regulation of Wnt signaling.Cancer Res. 2009 Apr 15;69(8):3278-82. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.