miRNA General Information
miRNA Mature ID hsa-miR-449a
miRNA Stemloop AC MI0001648
miRNA Stemloop ID hsa-mir-449a
Sequence uggcaguguauuguuagcuggu
TTD Target(s) Regulated by This miRNA Histone deacetylase 1 (HDAC1) Successful Target Target Info [1]
Cyclin-dependent kinase 4 (CDK4) Successful Target Target Info [2]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [2]
Proto-oncogene c-Met (MET) Successful Target Target Info [3]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [4]
ERK activator kinase 1 (MEK1) Clinical trial Target Target Info [5]
NAD-dependent deacetylase sirtuin-1 (SIRT1) Clinical trial Target Target Info [3]
Mammalian disintegrin-metalloprotease (ADAM10) Clinical trial Target Target Info [6]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [7]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [8]
Histone deacetylase 8 (HDAC8) Clinical trial Target Target Info [1]
M-phase inducer phosphatase 1 (MPIP1) Literature-reported Target Target Info [2]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [9]
Hepatocyte nuclear factor 4-alpha (HNF4A) Literature-reported Target Target Info [10]
Proto-oncogene c-Fos (c-Fos) Literature-reported Target Target Info [11]
Geminin (GMNN) Literature-reported Target Target Info [3]
IP3 receptor isoform 1 (ITPR1) Literature-reported Target Target Info [5]
N-myc proto-oncogene protein (MYCN) Literature-reported Target Target Info [12]
G1/S-specific cyclin-E2 (CCNE2) Literature-reported Target Target Info [3]
Protein(s) Regulated by This miRNA Calpain-6 Regulated Protein [13]
Cyclic AMP-responsive element-binding protein 5 Regulated Protein [14]
Cysteine-rich protein 2 Regulated Protein [15]
Flotillin-2 Regulated Protein [16]
Lymphoid enhancer-binding factor 1 Regulated Protein [17]
Microfibril-associated glycoprotein 4 Regulated Protein [18]
Myc-associated zinc finger protein Regulated Protein [19]
Plakophilin-4 Regulated Protein [18]
POU domain, class 2, transcription factor 1 Regulated Protein [13]
Ras-related protein R-Ras Regulated Protein [20]
tRNA-splicing endonuclease subunit Sen15 Regulated Protein [18]
WNT1-inducible-signaling pathway protein 2 Regulated Protein [21]
References
REF 1 miR-449a targets HDAC-1 and induces growth arrest in prostate cancer. Oncogene. 2009 Apr 9;28(14):1714-24.
REF 2 miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A. Genes Dev. 2009 Oct 15;23(20):2388-93.
REF 3 miR-449 inhibits cell proliferation and is down-regulated in gastric cancer. Mol Cancer. 2011 Mar 18;10:29.
REF 4 EVI1-mediated down regulation of MIR449A is essential for the survival of EVI1 positive leukaemic cells. Br J Haematol. 2011 Aug;154(3):337-48.
REF 5 The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66.
REF 6 miR-449a inhibits proliferation and invasion by regulating ADAM10 in hepatocellular carcinoma. Am J Transl Res. 2016 Jun 15;8(6):2609-19.
REF 7 miR-449a causes Rb-dependent cell cycle arrest and senescence in prostate cancer cells. Oncotarget. 2010 Sep;1(5):349-58.
REF 8 Hepatitis C virus mediated changes in miRNA-449a modulates inflammatory biomarker YKL40 through components of the NOTCH signaling pathway. PLoS One. 2012;7(11):e50826.
REF 9 Rapid identification of regulatory microRNAs by miTRAP (miRNA trapping by RNA in vitro affinity purification). Nucleic Acids Res. 2014 Apr;42(8):e66.
REF 10 The role of microRNAs in hepatocyte nuclear factor-4alpha expression and transactivation. Biochim Biophys Acta. 2013 May;1829(5):436-42.
REF 11 MiR-449a suppresses the epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma by multiple targets. BMC Cancer. 2015 Oct 15;15:706.
REF 12 MiR-449a Affects Epithelial Proliferation during the Pseudoglandular and Canalicular Phases of Avian and Mammal Lung Development. PLoS One. 2016 Feb 18;11(2):e0149425.
REF 13 miR-449a promotes liver cancer cell apoptosis by downregulation of Calpain 6 and POU2F1.Oncotarget. 2016 Mar 22;7(12):13491-501.
REF 14 Epigenetically regulated miR-449a enhances hepatitis B virus replication by targeting cAMP-responsive element binding protein 5 and modulating hepatocytes phenotype.Sci Rep. 2016 May 3;6:25389.
REF 15 MiR-449a promotes breast cancer progression by targeting CRIP2.Oncotarget. 2016 Apr 5;7(14):18906-18.
REF 16 miR-449a targets Flot2 and inhibits gastric cancer invasion by inhibiting TGF--mediated EMT.Diagn Pathol. 2015 Nov 14;10:202.
REF 17 miR-449a regulates the chondrogenesis of human mesenchymal stem cells through direct targeting of lymphoid enhancer-binding factor-1.Stem Cells Dev. 2012 Dec 10;21(18):3298-308.
REF 18 microRNA-449a functions as a tumor suppressor in neuroblastoma through inducing cell differentiation and cell cycle arrest. RNA Biol. 2015;12(5):538-54.
REF 19 MiR-449a exerts tumor-suppressive functions in human glioblastoma by targeting Myc-associated zinc-finger protein.Mol Oncol. 2015 Mar;9(3):640-56.
REF 20 miR-34/449 control apical actin network formation during multiciliogenesis through small GTPase pathways.Nat Commun. 2015 Sep 18;6:8386.
REF 21 MicroRNA signature of primary pigmented nodular adrenocortical disease: clinical correlations and regulation of Wnt signaling.Cancer Res. 2009 Apr 15;69(8):3278-82.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.