miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-491-5p | ||||
| miRNA Stemloop AC | MI0003126 | ||||
| miRNA Stemloop ID | hsa-mir-491 | ||||
| Sequence | aguggggaacccuuccaugagg | ||||
| TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
| Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [2] | ||
| Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | ||
| Dopamine transporter (DAT) | Successful Target | Target Info | [3] | ||
| Mothers against decapentaplegic homolog 3 (SMAD3) | Successful Target | Target Info | [4] | ||
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [5] | ||
| Apoptosis regulator Bcl-xL (BCL-xL) | Clinical trial Target | Target Info | [6] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [7] | ||
| Notch-3 receptor (NOTCH3) | Clinical trial Target | Target Info | [8] | ||
| Protein(s) Regulated by This miRNA | ARF GTPase-activating protein GIT1 | Regulated Protein | [9] | ||
| Calpain small subunit 1 | Regulated Protein | [10] | |||
| Chromodomain-helicase-DNA-binding protein 4 | Regulated Protein | [11] | |||
| Insulin-like growth factor 2 mRNA-binding protein 1 | Regulated Protein | [12] | |||
| Lysine-specific demethylase 4B | Regulated Protein | [13] | |||
| Protein Wnt-3a | Regulated Protein | [14] | |||
| Transcription initiation factor TFIID subunit 10 | Regulated Protein | [11] | |||
| References | |||||
| REF 1 | Two mature products of MIR-491 coordinate to suppress key cancer hallmarks in glioblastoma. Oncogene. 2015 Mar 26;34(13):1619-1628. | ||||
| REF 2 | MicroRNA-491 is involved in metastasis of hepatocellular carcinoma by inhibitions of matrix metalloproteinase and epithelial to mesenchymal transition. Liver Int. 2013 Sep;33(8):1271-80. | ||||
| REF 3 | miR-137 and miR-491 Negatively Regulate Dopamine Transporter Expression and Function in Neural Cells. Neurosci Bull. 2016 Dec;32(6):512-522. | ||||
| REF 4 | Inhibition of TGF-/SMAD3/NF-B signaling by microRNA-491 is involved in arsenic trioxide-induced anti-angiogenesis in hepatocellular carcinoma cells. Toxicol Lett. 2014 Nov 18;231(1):55-61. | ||||
| REF 5 | Identification of MMP-9 specific microRNA expression profile as potential targets of anti-invasion therapy in glioblastoma multiforme. Brain Res. 2011 Sep 9;1411:108-15. | ||||
| REF 6 | miR-122 targets an anti-apoptotic gene, Bcl-w, in human hepatocellular carcinoma cell lines. Biochem Biophys Res Commun. 2008 Oct 24;375(3):315-20. | ||||
| REF 7 | MicroRNA miR-491-5p targeting both TP53 and Bcl-XL induces cell apoptosis in SW1990 pancreatic cancer cells through mitochondria mediated pathway. Molecules. 2012 Dec 11;17(12):14733-47. | ||||
| REF 8 | miR-491-5p suppresses cell growth and invasion by targeting Notch3 in nasopharyngeal carcinoma. Oncol Rep. 2016 Jun;35(6):3541-7. | ||||
| REF 9 | miRNA-491-5p and GIT1 serve as modulators and biomarkers for oral squamous cell carcinoma invasion and metastasis.Cancer Res. 2014 Feb 1;74(3):751-64. | ||||
| REF 10 | MiR-99a and MiR-491 Regulate Cisplatin Resistance in Human Gastric Cancer Cells by Targeting CAPNS1. Int J Biol Sci. 2016 Nov 5;12(12):1437-1447. | ||||
| REF 11 | MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9. | ||||
| REF 12 | MicroRNAs-491-5p suppresses cell proliferation and invasion by inhibiting IGF2BP1 in non-small cell lung cancer. Am J Transl Res. 2016 Feb 15;8(2):485-95. | ||||
| REF 13 | miR-491-5p functions as a tumor suppressor by targeting JMJD2B in ER-positive breast cancer.FEBS Lett. 2015 Mar 24;589(7):812-21. | ||||
| REF 14 | miR-491-5p, mediated by Foxi1, functions as a tumor suppressor by targeting Wnt3a/-catenin signaling in the development of gastric cancer.Cell Death Dis. 2017 Mar 30;8(3):e2714. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.