Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T00176 Target Info
Target Name Ubiquitin-protein ligase E3 Mdm2 (MDM2)
Synonyms RING-type E3 ubiquitin transferase Mdm2; P53-binding protein Mdm2; Oncoprotein Mdm2; MDM2 protein; Hdm2; E3 ubiquitin-protein ligase Mdm2; Double minute 2 protein
Target Type Clinical trial Target
Gene Name MDM2
Biochemical Class Acyltransferase
UniProt ID
Q00987
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 In Situ Hybridization [3]
2 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Western Blot; Luciferase Reporter Assay [4]
2 PAR-CLIP [5]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-18b-5p miRNA Info
miRNA Mature AC
MIMAT0001412
Sequence uaaggugcaucuagugcaguuag
miRNA Species Homo sapiens
Regulation Mechanism The conserved nucleotides in the 3'UTR of MDM2 were responsible for miR-18b targeting in vitro. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
2 PAR-CLIP [5]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism Co-transfection of this construct with pre-miR-25 oligonucleotides decreased that luciferase activity compared with the scrambled oligonucleotides, whereas the reporter with a mutated seed region did not. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Western Blot [10]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-339-5p miRNA Info
miRNA Mature AC
MIMAT0000764
Sequence ucccuguccuccaggagcucacg
miRNA Species Homo sapiens
Regulation Mechanism MDM2 3'UTR contains functional sites that can be bound by miR-339-5p and that the presence of these sites can mediate repression of the transcript. [11]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [11]
2 Western Blot [12]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Protein tyrosine phosphatase IVA 1 (PRL-1) Target Info
TP4A1_HUMAN
miRNA Mature ID hsa-miR-661 miRNA Info
miRNA Mature AC
MIMAT0003324
Sequence ugccugggucucuggccugcgcgu
miRNA Species Homo sapiens
Regulation Mechanism miR-661 interacts with MDM2 RNA. Downregulation of MDM2 by miR-661 augments p53 activity and inhibits cell cycle progression. [14]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; RT-PCR [13]
2 qRT-PCR; Western Blot [14]
Representative Target(s) Regulated by This miRNA Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Target Info
MCL1_HUMAN
Metastasis associated gene-1 (MTA1) Target Info
MTA1_HUMAN
miRNA Mature ID hsa-miR-32-5p miRNA Info
miRNA Mature AC
MIMAT0000090
Sequence uauugcacauuacuaaguugca
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-32 led to significantly decreased levels of endogenous MDM2 compared with scrambled cells and increased p53 protein. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Aurora kinase A (AURKA) Target Info
AURKA_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with the miR-340 resulted in a decreased both mRNA and protein levels of MDM2. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-410-3p miRNA Info
miRNA Mature AC
MIMAT0002171
Sequence aauauaacacagauggccugu
miRNA Species Homo sapiens
Regulation Mechanism miR-410 acted as a new tumor suppressor by targeting the MDM2 gene. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
G2/mitotic-specific cyclin B1 (CCNB1) Target Info
CCNB1_HUMAN
miRNA Mature ID hsa-miR-504-5p miRNA Info
miRNA Mature AC
MIMAT0002875
Sequence agacccuggucugcacucuauc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [17]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-367-3p miRNA Info
miRNA Mature AC
MIMAT0000719
Sequence aauugcacuuuagcaaugguga
miRNA Species Homo sapiens
Regulation Mechanism miR-367-3p could increase AR expression via directly targeting the 3'UTR of MDM2 to decrease MDM2 protein expression. [18]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
Kruppel like factor 4 (KLF4) Target Info
KLF4_HUMAN
miRNA Mature ID hsa-miR-605-5p miRNA Info
miRNA Mature AC
MIMAT0003273
Sequence uaaaucccauggugccuucuccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Gankyrin (PSMD10) Target Info
PSD10_HUMAN
miRNA Mature ID hsa-miR-610 miRNA Info
miRNA Mature AC
MIMAT0003278
Sequence ugagcuaaaugugugcuggga
miRNA Species Homo sapiens
Regulation Mechanism MDM2 is a direct target gene of miR-610. miR-610 regulates glioma cell proliferation, migration and invasion by targeting MDM2. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Hepatoma-derived growth factor (HDGF) Target Info
HDGF_HUMAN
Ubiquitin-protein ligase E3 Mdm2 (MDM2) Target Info
MDM2_HUMAN
References  Top
REF 1 Loss of microRNA-143/145 disturbs cellular growth and apoptosis of human epithelial cancers by impairing the MDM2-p53 feedback loop. Oncogene. 2013 Jan 3;32(1):61-9.
REF 2 LncRNA UCA1 protects cardiomyocytes against hypoxia/reoxygenation induced apoptosis through inhibiting miR-143/MDM2/p53 axis. Genomics. 2019 Apr 15. pii: S0888-7543(18)30528-7.
REF 3 MicroRNA regulation of MDM2-p53 loop in pterygium. Exp Eye Res. 2018 Apr;169:149-156.
REF 4 Stress response of glioblastoma cells mediated by miR-17-5p targeting PTEN and the passenger strand miR-17-3p targeting MDM2. Oncotarget. 2012 Dec;3(12):1653-68.
REF 5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6 The role of miR-18b in MDM2-p53 pathway signaling and melanoma progression. J Natl Cancer Inst. 2013 Mar 20;105(6):433-42.
REF 7 The oncoprotein HBXIP promotes human breast cancer growth through down-regulating p53 via miR-18b/MDM2 and pAKT/MDM2 pathways. Acta Pharmacol Sin. 2018 Nov;39(11):1787-1796.
REF 8 p53/mdm2 feedback loop sustains miR-221 expression and dictates the response to anticancer treatments in hepatocellular carcinoma. Mol Cancer Res. 2014 Feb;12(2):203-16.
REF 9 MicroRNAs/TP53 feedback circuitry in glioblastoma multiforme. Proc Natl Acad Sci U S A. 2012 Apr 3;109(14):5316-21.
REF 10 Function of miR-25 in the invasion and metastasis of esophageal squamous carcinoma cells and bioinformatical analysis of the miR-106b-25 cluster. Exp Ther Med. 2018 Jan;15(1):440-446.
REF 11 miR-339-5p regulates the p53 tumor-suppressor pathway by targeting MDM2. Oncogene. 2015 Apr 9;34(15):1908-18.
REF 12 The regulation of the p53/MDM2 feedback loop by microRNAs. RNA Dis. 2015;2(1):e502.
REF 13 Mouse double minute homologue 2 (MDM2) downregulation by miR-661 impairs human endometrial epithelial cell adhesive capacity. Reprod Fertil Dev. 2018 Mar;30(3):477-486.
REF 14 miR-661 downregulates both Mdm2 and Mdm4 to activate p53. Cell Death Differ. 2014 Feb;21(2):302-9.
REF 15 MicroRNA-340 inhibits prostate cancer cell proliferation and metastasis by targeting the MDM2-p53 pathway. Oncol Rep. 2016 Feb;35(2):887-95.
REF 16 MicroRNA-410 suppresses migration and invasion by targeting MDM2 in gastric cancer. PLoS One. 2014 Aug 19;9(8):e104510.
REF 17 Negative regulation of tumor suppressor p53 by microRNA miR-504. Mol Cell. 2010 Jun 11;38(5):689-99.
REF 18 The miR-367-3p Increases Sorafenib Chemotherapy Efficacy to Suppress Hepatocellular Carcinoma Metastasis through Altering the Androgen Receptor Signals. EBioMedicine. 2016 Oct;12:55-67.
REF 19 miR-605 joins p53 network to form a p53:miR-605:Mdm2 positive feedback loop in response to stress. EMBO J. 2011 Feb 2;30(3):524-32.
REF 20 MicroRNA-610 is downregulated in glioma cells, and inhibits proliferation and motility by directly targeting MDM2. Mol Med Rep. 2016 Sep;14(3):2657-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.