Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T02723 Target Info
Target Name Interferon regulatory factor 1 (IRF1)
Synonyms IRF-1
Target Type Literature-reported Target
Gene Name IRF1
UniProt ID
P10914
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism IRF1 is directly targeted by miR-23a. [2]
Evidence Score (E-score) 2 +
1 Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot; GFP Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-383-5p miRNA Info
miRNA Mature AC
MIMAT0000738
Sequence agaucagaaggugauuguggcu
miRNA Species Homo sapiens
Regulation Mechanism IRF1 is a direct target of miR-383. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-130b led to suppression of IRF1. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-502-5p miRNA Info
miRNA Mature AC
MIMAT0002873
Sequence auccuugcuaucugggugcua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Interferon regulatory factor 1 (IRF1) Target Info
IRF1_HUMAN
SET domain containing 8 (KMT5A) Target Info
KMT5A_HUMAN
References  Top
REF 1 MicroRNA-23a downregulates the expression of interferon regulatory factor-1 in hepatocellular carcinoma cells. Oncol Rep. 2016 Aug;36(2):633-40.
REF 2 miR-23a targets interferon regulatory factor 1 and modulates cellular proliferation and paclitaxel-induced apoptosis in gastric adenocarcinoma cells. PLoS One. 2013 Jun 10;8(6):e64707.
REF 3 miR-383 promotes cholangiocarcinoma cell proliferation, migration, and invasion through targeting IRF1. J Cell Biochem. 2018 Dec;119(12):9720-9729.
REF 4 Downregulation of microRNA-383 is associated with male infertility and promotes testicular embryonal carcinoma cell proliferation by targeting IRF1. Cell Death Dis. 2010 Nov 4;1:e94.
REF 5 Repression of microRNA-130b by thyroid hormone enhances cell motility. J Hepatol. 2015 Jun;62(6):1328-40.
REF 6 Rs56288038 (C/G) in 3'UTR of IRF-1 Regulated by MiR-502-5p Promotes Gastric Cancer Development. Cell Physiol Biochem. 2016;40(1-2):391-399.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.