Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T03755 Target Info
Target Name Apoptosis regulator Bcl-W (BCL-W)
Synonyms KIAA0271; Bcl2-L-2; Bcl-2-like protein 2; BCLW
Target Type Clinical trial Target
Gene Name BCL2L2
Biochemical Class B-cell lymphoma Bcl-2
UniProt ID
Q92843
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism miR-133b directly targets the 3 UTRs of BCL2L2. [5]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; Western Blot [3]
4 Western Blot [4]
5 Western Blot; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Immunoblot; Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR [6]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
4 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-630 miRNA Info
miRNA Mature AC
MIMAT0003299
Sequence aguauucuguaccagggaaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [10]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [11]
3 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-122-5p resulted in the decreased protein level of target BCL2L2. [11]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [13]
2 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [14]
2 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism BCL2L2 is a direct target of miR-195. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism BCL2L2 was validated as direct targets of miR-204. Down-regulation of expressions at protein levels of BCL2L2 was confirmed by Western blot. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism BCL2L2 is a direct target of miR-214. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-129-2-3p miRNA Info
miRNA Mature AC
MIMAT0004605
Sequence aagcccuuaccccaaaaagcau
miRNA Species Homo sapiens
Regulation Mechanism miR-129-2-3p functions as a tumor suppressor by inducing the apoptosis of breast cancer cells by targeting BCL2L2. [19]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
References  Top
REF 1 Down-Regulation of MicroRNA-133b Suppresses Apoptosis of Lens Epithelial Cell by Up-Regulating BCL2L2 in Age-Related Cataracts. Med Sci Monit. 2016 Nov 1;22:4139-4145.
REF 2 MiR-133b regulates bladder cancer cell proliferation and apoptosis by targeting Bcl-w and Akt1. Cancer Cell Int. 2014 Jul 19;14:70.
REF 3 The role of microRNA-133 in cardiac hypertrophy uncovered. Circ Res. 2010 Jan 8;106(1):16-8.
REF 4 MiR-133b is down-regulated in human osteosarcoma and inhibits osteosarcoma cells proliferation, migration and invasion, and promotes apoptosis. PLoS One. 2013 Dec 31;8(12):e83571.
REF 5 MicroRNA 133B targets pro-survival molecules MCL-1 and BCL2L2 in lung cancer. Biochem Biophys Res Commun. 2009 Oct 23;388(3):483-9.
REF 6 Acetylation of p53 stimulates miRNA processing and determines cell survival following genotoxic stress. EMBO J. 2013 Dec 11;32(24):3192-205.
REF 7 Berberine modulates cisplatin sensitivity of human gastric cancer cells by upregulation of miR-203. In Vitro Cell Dev Biol Anim. 2016 Sep;52(8):857-63.
REF 8 MicroRNA-203 Is a Prognostic Indicator in Bladder Cancer and Enhances Chemosensitivity to Cisplatin via Apoptosis by Targeting Bcl-w and Survivin. PLoS One. 2015 Nov 23;10(11):e0143441.
REF 9 microRNA-203 suppresses bladder cancer development by repressing bcl-w expression. FEBS J. 2011 Mar;278(5):786-92.
REF 10 Phospho-Np63 is a key regulator of the cisplatin-induced microRNAome in cancer cells. Cell Death Differ. 2011 Jul;18(7):1220-30.
REF 11 miR-122 targets an anti-apoptotic gene, Bcl-w, in human hepatocellular carcinoma cell lines. Biochem Biophys Res Commun. 2008 Oct 24;375(3):315-20.
REF 12 Novel Epigenetic CREB-miR-630 Signaling Axis Regulates Radiosensitivity in Colorectal Cancer. PLoS One. 2015 Aug 11;10(8):e0133870.
REF 13 Regulation of Apoptosis by miR-122 in Pterygium via Targeting Bcl-w. Invest Ophthalmol Vis Sci. 2016 Jul 1;57(8):3723-30.
REF 14 Effect of miR-335 upregulation on the apoptosis and invasion of lung cancer cell A549 and H1299. Tumour Biol. 2013 Oct;34(5):3101-9.
REF 15 MicroRNA-335 acts as a metastasis suppressor in gastric cancer by targeting Bcl-w and specificity protein 1. Oncogene. 2012 Mar 15;31(11):1398-407.
REF 16 MicroRNA-195 chemosensitizes colon cancer cells to the chemotherapeutic drug doxorubicin by targeting the first binding site of BCL2L2 mRNA. J Cell Physiol. 2015 Mar;230(3):535-45.
REF 17 Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2011 May 6;52(6):2999-3007.
REF 18 MiR-214 reduces cell survival and enhances cisplatin-induced cytotoxicity via down-regulation of Bcl2l2 in cervical cancer cells. FEBS Lett. 2013 Mar 1;587(5):488-95.
REF 19 Downregulation of miR-129-2 by promoter hypermethylation regulates breast cancer cell proliferation and apoptosis. Oncol Rep. 2016 May;35(5):2963-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.