Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T06273 Target Info
Target Name Poly [ADP-ribose] polymerase 1 (PARP1)
Synonyms Protein poly-ADP-ribosyltransferase PARP1; Poly[ADP-ribose] synthetase-1; Poly[ADP-ribose] synthase 1; Poly(ADP-ribose)polymerase-1; PPOL; PARP-1; NAD(+)Poly [ADP-ribose] polymerase-1 ADP-ribosyltransferase-1; NAD(+) ADP-ribosyltransferase-1; NAD(+) ADP-ribosyltransferase 1; DNA ADP-ribosyltransferase PARP1; ARTD1; ADPRT 1; ADPRT; ADP-ribosyltransferase diphtheria toxin-like 1
Target Type Successful Target
Gene Name PARP1
Biochemical Class Glycosyltransferases
UniProt ID
P09874
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism PARP1 is a target gene of miR-223 in the esophagus. Cotransfection of the miR-223 mimic, plasmid DNA consisting of a 3'UTR clone of PARP1 fused to the firefly luciferase gene, and the Renilla luciferase vector as transfection control resulted in a 2.7-fold decreased firefly luciferase activity compared with cotransfection with a scramble miRNA. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 RT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-216b-5p miRNA Info
miRNA Mature AC
MIMAT0004959
Sequence aaaucucugcaggcaaauguga
miRNA Species Homo sapiens
Regulation Mechanism miR-216b directly targets and inhibits PARP1 expression. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Regulation Mechanism miR-335 promotes chemo-radiosensitization by targeting PARP-1 through NF-KB. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-708 reduced the expression of PPAT1. [5]
Evidence Score (E-score) 1 +
1 Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA 223 is upregulated in the multistep progression of Barrett's esophagus and modulates sensitivity to chemotherapy by targeting PARP1. Clin Cancer Res. 2013 Aug 1;19(15):4067-78.
REF 2 Role of microRNA-223 in the regulation of poly(ADP-ribose) polymerase in pediatric patients with Crohn's disease. Scand J Gastroenterol. 2018 Sep;53(9):1066-1073.
REF 3 MiR-216b increases cisplatin sensitivity in ovarian cancer cells by targeting PARP1. Cancer Gene Ther. 2017 May;24(5):208-214.
REF 4 MiR-335 regulates the chemo-radioresistance of small cell lung cancer cells by targeting PARP-1. Gene. 2017 Feb 5;600:9-15.
REF 5 miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.