Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T14006 Target Info
Target Name CDK inhibitor 1B p27Kip1 (CDKN1B)
Synonyms p27Kip1; KIP1; Cyclindependent kinase inhibitor p27; Cyclin-dependent kinase inhibitor p27; Cyclin-dependent kinase inhibitor 1B
Target Type Literature-reported Target
Gene Name CDKN1B
UniProt ID
P46527
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-221-3p by mature miRNA precursor transfection resulted in the decreased protein level of target CDKN1B. [19]
Evidence Score (E-score) 23 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Immunohistochemistry; Microarray; qRT-PCR [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay [4]
5 Luciferase Reporter Assay [5]
6 Luciferase Reporter Assay [6]
7 Luciferase Reporter Assay [7]
8 Luciferase Reporter Assay [8]
9 Luciferase Reporter Assay [9]
10 Luciferase Reporter Assay; Northern Blot; Western Blot [10]
11 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
12 Luciferase Reporter Assay; qRT-PCR; Western Blot [12]
13 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
14 Luciferase Reporter Assay; qRT-PCR; Western Blot; Reporter Assay [14]
15 Luciferase Reporter Assay; Western Blot [15]
16 Luciferase Reporter Assay; Western Blot [16]
17 Luciferase Reporter Assay; Western Blot [17]
18 Luciferase Reporter Assay; Western Blot [18]
19 Luciferase Reporter Assay; Western Blot [19]
20 Northern Blot; qRT-PCR; Western Blot [20]
21 qRT-PCR; Luciferase Reporter Assay; Western Blot [21]
22 qRT-PCR; Western Blot [22]
23 Western Blot; Northern Blot [23]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-222-3p by LNA Antisense miRNA Oligonucleotide resulted in the changed protein level of target CDKN1B. [19]
Evidence Score (E-score) 17 +
1 Immunofluorescence; Luciferase Reporter Assay; Western Blot [24]
2 Immunohistochemistry; Microarray; qRT-PCR [2]
3 Luciferase Reporter Assay [4]
4 Luciferase Reporter Assay [5]
5 Luciferase Reporter Assay [8]
6 Luciferase Reporter Assay [9]
7 Luciferase Reporter Assay [18]
8 Luciferase Reporter Assay [19]
9 Luciferase Reporter Assay; Northern Blot; Western Blot [10]
10 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
11 Luciferase Reporter Assay; Western Blot [15]
12 Luciferase Reporter Assay; Western Blot [16]
13 Northern Blot; qRT-PCR; Western Blot [20]
14 qRT-PCR; Luciferase Reporter Assay; Western Blot [21]
15 qRT-PCR; Western Blot [22]
16 Western Blot; Northern Blot [23]
17 Western Blot; Reporter Assay [14]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [25]
2 PAR-CLIP [26]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [27]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism P27, a key inhibitor of cell cycle, was identified as the direct target of miR-148a, suggesting that miR-148a might exert its function through the downregulation of p27. [28]
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Luciferase Reporter Assay; Northern Blot; Western Blot [28]
2 Luciferase Reporter Assay; Western Blot [29]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-452-5p miRNA Info
miRNA Mature AC
MIMAT0001635
Sequence aacuguuugcagaggaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [30]
2 PAR-CLIP [26]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Dihydropyrimidinase related protein 2 (DPYSL2) Target Info
DPYL2_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7 binds to the 3'UTR of p27 to regulate its expression. [31]
Evidence Score (E-score) 1 +
1 Immunoblot [31]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot [32]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [33]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [18]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-203a-5p miRNA Info
miRNA Mature AC
MIMAT0031890
Sequence agugguucuuaacaguucaacaguu
miRNA Species Homo sapiens
Regulation Mechanism miR203 suppression decreased the levels of cell-cycle inhibitor p27. [34]
Evidence Score (E-score) 1 +
1 Western Blot [34]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-296-5p resulted in the changed protein level of target CCKN1B. [19]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [19]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-148a-5p miRNA Info
miRNA Mature AC
MIMAT0004549
Sequence aaaguucugagacacuccgacu
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR-luciferase assays in 293T cells suggested that specific targeting of miR-148a occurs on the 3'UTR of CDKN1B, and transfection of miR-148a mimic into LNCaP cells was sufficient to reduce CDKN1B protein expression. [35]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [35]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-181a-5p miRNA Info
miRNA Mature AC
MIMAT0000256
Sequence aacauucaacgcugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-181a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CDKN1B. [19]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [19]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-190a-5p miRNA Info
miRNA Mature AC
MIMAT0000458
Sequence ugauauguuugauauauuaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [18]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Insulin-like growth factor-I (IGF1) Target Info
IGF1_HUMAN
miRNA Mature ID hsa-miR-221-5p miRNA Info
miRNA Mature AC
MIMAT0004568
Sequence accuggcauacaauguagauuu
miRNA Species Homo sapiens
Regulation Mechanism P27KIP1 increased when miR-221 was inhibited. [36]
Evidence Score (E-score) 1 +
1 Co-Immunoprecipitation; Chromatin Immunoprecipitation; Western Blot [36]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
miRNA Mature ID hsa-miR-323a-3p miRNA Info
miRNA Mature AC
MIMAT0000755
Sequence cacauuacacggucgaccucu
miRNA Species Homo sapiens
Regulation Mechanism The transfection with miR-323-3p mimics downregulated the expression of CDKN1B. [37]
Evidence Score (E-score) 1 +
1 qRT-PCR [37]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
References  Top
REF 1 In vitro and in vivo activity of a novel locked nucleic acid (LNA)-inhibitor-miR-221 against multiple myeloma cells. PLoS One. 2014 Feb 21;9(2):e89659.
REF 2 Upregulation of mir-221 and mir-222 in atypical teratoid/rhabdoid tumors: potential therapeutic targets. Childs Nerv Syst. 2010 Mar;26(3):279-83.
REF 3 miR-128b is a potent glucocorticoid sensitizer in MLL-AF4 acute lymphocytic leukemia cells and exerts cooperative effects with miR-221. Blood. 2009 Nov 5;114(19):4169-78.
REF 4 A necessary role of miR-221 and miR-222 in vascular smooth muscle cell proliferation and neointimal hyperplasia. Circ Res. 2009 Feb 27;104(4):476-87.
REF 5 MicroRNA-221 and -222 pathway controls melanoma progression. Expert Rev Anticancer Ther. 2008 Nov;8(11):1759-65.
REF 6 Effects of miR-34a on cell growth and chemoresistance in prostate cancer PC3 cells. Biochem Biophys Res Commun. 2008 Dec 5;377(1):114-9.
REF 7 MiR-221 controls CDKN1C/p57 and CDKN1B/p27 expression in human hepatocellular carcinoma. Oncogene. 2008 Sep 25;27(43):5651-61.
REF 8 MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer. Oncogene. 2008 Jun 19;27(27):3845-55.
REF 9 MicroRNAs (miR)-221 and miR-222, both overexpressed in human thyroid papillary carcinomas, regulate p27Kip1 protein levels and cell cycle. Endocr Relat Cancer. 2007 Sep;14(3):791-8.
REF 10 Co-suppression of miR-221/222 cluster suppresses human glioma cell growth by targeting p27kip1 in vitro and in vivo. Int J Oncol. 2009 Jun;34(6):1653-60.
REF 11 Inhibiting the oncogenic mir-221 by microRNA sponge: toward microRNA-based therapeutics for hepatocellular carcinoma. Gastroenterol Hepatol Bed Bench. 2014 Winter;7(1):43-54.
REF 12 Induction of microRNA-221 by platelet-derived growth factor signaling is critical for modulation of vascular smooth muscle phenotype. J Biol Chem. 2009 Feb 6;284(6):3728-38.
REF 13 The promyelocytic leukemia zinc finger-microRNA-221/-222 pathway controls melanoma progression through multiple oncogenic mechanisms. Cancer Res. 2008 Apr 15;68(8):2745-54.
REF 14 Regulation of p27Kip1 by miRNA 221/222 in glioblastoma. Cell Cycle. 2007 Aug 15;6(16):2005-9.
REF 15 Microrna-221 and microrna-222 modulate differentiation and maturation of skeletal muscle cells. PLoS One. 2009 Oct 27;4(10):e7607.
REF 16 MicroRNAs 221 and 222 bypass quiescence and compromise cell survival. Cancer Res. 2008 Apr 15;68(8):2773-80.
REF 17 RNA-binding protein Dnd1 inhibits microRNA access to target mRNA. Cell. 2007 Dec 28;131(7):1273-86.
REF 18 Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation. EMBO J. 2007 Aug 8;26(15):3699-708.
REF 19 miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1. J Biol Chem. 2007 Aug 10;282(32):23716-24.
REF 20 miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A. 2010 Jan 5;107(1):264-9.
REF 21 Functional links between clustered microRNAs: suppression of cell-cycle inhibitors by microRNA clusters in gastric cancer. Nucleic Acids Res. 2009 Apr;37(5):1672-81.
REF 22 MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27Kip1. J Biol Chem. 2008 Oct 31;283(44):29897-903.
REF 23 The inhibition of the highly expressed miR-221 and miR-222 impairs the growth of prostate carcinoma xenografts in mice. PLoS One. 2008;3(12):e4029.
REF 24 miR-222 is upregulated in epithelial ovarian cancer and promotes cell proliferation by downregulating P27kip1. Oncol Lett. 2013 Aug;6(2):507-512.
REF 25 MicroRNA-200b stimulates tumour growth in TGFBR2-null colorectal cancers by negatively regulating p27/kip1. J Cell Physiol. 2014 Jun;229(6):772-82.
REF 26 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 27 TGF-1 stimulates human Tenon's capsule fibroblast proliferation by miR-200b and its targeting of p27/kip1 and RND3. Invest Ophthalmol Vis Sci. 2014 Apr 28;55(4):2747-56.
REF 28 miR-148a promoted cell proliferation by targeting p27 in gastric cancer cells. Int J Biol Sci. 2011 May 5;7(5):567-74.
REF 29 MiR-148a participates in the growth of RPMI8226 multiple myeloma cells by regulating CDKN1B. Biomed Pharmacother. 2016 Dec;84:1967-1971.
REF 30 MicroRNA-452 promotes tumorigenesis in hepatocellular carcinoma by targeting cyclin-dependent kinase inhibitor 1B. Mol Cell Biochem. 2014 Apr;389(1-2):187-95.
REF 31 DICER-dependent biogenesis of let-7 miRNAs affects human cell response to DNA damage via targeting p21/p27. Nucleic Acids Res. 2015 Feb 18;43(3):1626-36.
REF 32 Healing the injured vessel wall using microRNA-facilitated gene delivery. J Clin Invest. 2014 Sep;124(9):3694-7.
REF 33 MicroRNA-182-5p targets a network of genes involved in DNA repair. RNA. 2013 Feb;19(2):230-42.
REF 34 MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42.
REF 35 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
REF 36 Epstein-Barr Virus Proteins EBNA3A and EBNA3C Together Induce Expression of the Oncogenic MicroRNA Cluster miR-221/miR-222 and Ablate Expression of Its Target p57KIP2. PLoS Pathog. 2015 Jul 8;11(7):e1005031.
REF 37 Increased microRNA-323-3p in IL-22/IL-17-producing T cells and asthma: a role in the regulation of the TGF- pathway and IL-22 production. Allergy. 2017 Jan;72(1):55-65.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.