Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T14592 Target Info
Target Name Apoptosis mediating surface antigen FAS (FAS)
Synonyms Tumor necrosis factor receptor superfamily member 6; TNFRSF6; FASLG receptor; FAS1; CD95; Apoptosis-mediating surface antigen FAS; Apo-1 antigen; APT1
Target Type Clinical trial Target
Gene Name FAS
Biochemical Class Cytokine receptor
UniProt ID
P25445
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-106a is closely associated with gastric cancer cell proliferation, apoptosis and invasion and FAS was negatively regulated by miR-106a. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Forced expression of miR-146a downregulated Fas expression via targeting its 3'UTR of this gene. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-196b-5p miRNA Info
miRNA Mature AC
MIMAT0001080
Sequence uagguaguuuccuguuguuggg
miRNA Species Homo sapiens
Regulation Mechanism The FAS mRNA level was lower in SW480 cells transfected with pre-mIR-196B than in un-transfected control cells. FAS protein expression was also down-regulated in miR-196B-overexpressing cells. [6]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism miR-23a had no effect on the luciferase control reporter without the Fas 3'UTR, implying that Fas is a direct target of miR-23a. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [9]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism miR-133b-5p directly targets FAS gene by interaction with the 3'untranslated region. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [9]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [9]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-504-5p miRNA Info
miRNA Mature AC
MIMAT0002875
Sequence agacccuggucugcacucuauc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [11]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-92a-1-5p miRNA Info
miRNA Mature AC
MIMAT0004507
Sequence agguugggaucgguugcaaugcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [9]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-92a-2-5p miRNA Info
miRNA Mature AC
MIMAT0004508
Sequence ggguggggauuuguugcauuac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [9]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 miR-106a is frequently upregulated in gastric cancer and inhibits the extrinsic apoptotic pathway by targeting FAS. Mol Carcinog. 2013 Aug;52(8):634-46.
REF 2 MicroRNA-106a functions as an oncogene in human gastric cancer and contributes to proliferation and metastasis in vitro and in vivo. Clin Exp Metastasis. 2016 Jun;33(5):509-19.
REF 3 Forced miR-146a expression causes autoimmune lymphoproliferative syndrome in mice via downregulation of Fas in germinal center B cells. Blood. 2013 Jun 13;121(24):4875-83.
REF 4 Diazoxide potentiates mesenchymal stem cell survival via NF-kappaB-dependent miR-146a expression by targeting Fas. Am J Physiol Heart Circ Physiol. 2010 Oct;299(4):H1077-82.
REF 5 miR-196b directly targets both HOXA9/MEIS1 oncogenes and FAS tumour suppressor in MLL-rearranged leukaemia. Nat Commun. 2012 Feb 21;3:688.
REF 6 MicroRNA 196B regulates FAS-mediated apoptosis in colorectal cancer cells. Oncotarget. 2015 Feb 20;6(5):2843-55.
REF 7 Up-regulated expression of miR-23a/b targeted the pro-apoptotic Fas in radiation-induced thymic lymphoma. Cell Physiol Biochem. 2013;32(6):1729-40.
REF 8 MicroRNA-23a modulates tumor necrosis factor-alpha-induced osteoblasts apoptosis by directly targeting Fas. J Cell Biochem. 2013 Dec;114(12):2738-45.
REF 9 Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.
REF 10 MicroRNA-133b-5p Is Involved in Cardioprotection of Morphine Preconditioning in Rat Cardiomyocytes by Targeting Fas. Can J Cardiol. 2016 Aug;32(8):996-1007.
REF 11 Negative regulation of tumor suppressor p53 by microRNA miR-504. Mol Cell. 2010 Jun 11;38(5):689-99.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.