The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-29c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccauuugaaaucgguua
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
3 |
+ |
1 |
Immunohistochemistry; qRT-PCR |
[1] |
2 |
Immunohistochemistry; qRT-PCR |
[2] |
3 |
Microarray; qRT-PCR |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
B7 homolog 3 (CD276)
|
Target Info
|
|
miRNA Mature ID |
hsa-let-7g-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaguaguuuguacaguu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
COL1A2 expression was significantly down-regulated in huH1-let7g cells at both the mRNA and protein levels. |
[4] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[4] |
2 |
Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
Caspase-3 (CASP3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-25-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cauugcacuugucucggucuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-25 is capable of suppressing COL1A2, involved in epithelial to mesenchymal transition and angiogenesis which are the typical diffuse type gastric cancer features. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunofluorescence |
[6] |
Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1C p57Kip2 (CDKN1C)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-26b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucaaguaauucaggauaggu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-26b mimic, but not miR-26b-mut, can specifically interact with the 3'UTR of Col1a2 gene. |
[7] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[7] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
Collagen I (COL1A2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccaucugaaaucgguua
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[8] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|