Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T31621 Target Info
Target Name Fibroblast growth factor-2 (FGF2)
Synonyms bFGF; Heparin-binding growth factor 2; HBGF-2; Fibroblast growth factor 2; FGFB; FGF-2; Basic fibroblast growth factor
Target Type Successful Target
Gene Name FGF2
Biochemical Class Growth factor
UniProt ID
P09038
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 ELISA; Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 PAR-CLIP [3]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; Northern Blot; qRT-PCR [4]
2 Luciferase Reporter Assay [5]
3 PAR-CLIP [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-186-5p miRNA Info
miRNA Mature AC
MIMAT0000456
Sequence caaagaauucuccuuuugggcu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [6]
2 Sequencing [3]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism miR-424 downregulation correlates with FGF2 upregulation in PAH PAECs. [4]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Northern Blot [4]
2 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR- 152 significantly suppressed levels of both FGF2 mRNA and protein, whereas the inhibition of miR-152 significantly increased these levels. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 PAR-CLIP [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism miR-203 directly targets FGF2 in human renal cancer cells. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-152-5p miRNA Info
miRNA Mature AC
MIMAT0026479
Sequence agguucugugauacacuccgacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-195-3p miRNA Info
miRNA Mature AC
MIMAT0004615
Sequence ccaauauuggcugugcugcucc
miRNA Species Homo sapiens
Regulation Mechanism miR-195 suppressed PCa cell metastasis by downregulating FGF2. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
miRNA Mature ID hsa-miR-205-3p miRNA Info
miRNA Mature AC
MIMAT0009197
Sequence gauuucaguggagugaaguuc
miRNA Species Homo sapiens
Regulation Mechanism miR-205 directly binds FGF2 mRNA 3'UTR and miR-205 levels are negatively correlated with FGF2 mRNA expression in breast cancer patients. [12]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
Vascular endothelial growth factor A (VEGFA) Target Info
VEGFA_HUMAN
References  Top
REF 1 MiR-195 is a key negative regulator of hepatocellular carcinoma metastasis by targeting FGF2 and VEGFA. Int J Clin Exp Pathol. 2015 Nov 1;8(11):14110-20.
REF 2 MicroRNA-195 inhibits human gastric cancer by directly targeting basic fibroblast growth factor. Clin Transl Oncol. 2017 Nov;19(11):1320-1328.
REF 3 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 4 An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. Nat Med. 2013 Jan;19(1):74-82.
REF 5 MicroRNA-503 targets FGF2 and VEGFA and inhibits tumor angiogenesis and growth. Cancer Lett. 2013 Jun 10;333(2):159-69.
REF 6 Dual Functional MicroRNA-186-5p Targets both FGF2 and RelA to Suppress Tumorigenesis of Glioblastoma Multiforme. Cell Mol Neurobiol. 2017 Nov;37(8):1433-1442.
REF 7 FOXO1-suppressed miR-424 regulates the proliferation and osteogenic differentiation of MSCs by targeting FGF2 under oxidative stress. Sci Rep. 2017 Feb 10;7:42331.
REF 8 MiR-152 suppresses the proliferation and invasion of NSCLC cells by inhibiting FGF2. Exp Mol Med. 2014 Sep 5;46:e112.
REF 9 miR-203 inhibition of renal cancer cell proliferation, migration and invasion by targeting of FGF2. Diagn Pathol. 2015 Apr 9;10:24.
REF 10 Long Noncoding RNA PVT1 Acts as a "Sponge" to Inhibit microRNA-152 in Gastric Cancer Cells. Dig Dis Sci. 2017 Nov;62(11):3021-3028.
REF 11 miR-195 Inhibits EMT by Targeting FGF2 in Prostate Cancer Cells. PLoS One. 2015 Dec 9;10(12):e0144073.
REF 12 miRNA-205 targets VEGFA and FGF2 and regulates resistance to chemotherapeutics in breast cancer. Cell Death Dis. 2016 Jun 30;7(6):e2291.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.