Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T39797 Target Info
Target Name Frizzled-7 receptor (FZD7)
Synonyms hFz7; FzE3; Fz7; Fz-7; Frizzled7; Frizzled-7
Target Type Clinical trial Target
Gene Name FZD7
Biochemical Class GPCR frizzled
UniProt ID
O75084
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-542-3p miRNA Info
miRNA Mature AC
MIMAT0003389
Sequence ugugacagauugauaacugaaa
miRNA Species Homo sapiens
Regulation Mechanism miR-542-3p inhibits HCC cell growth by targeting FZD7 and inhibiting Wnt signaling pathway. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Angiopoietin-2 (ANGPT2) Target Info
ANGP2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-485-5p miRNA Info
miRNA Mature AC
MIMAT0002175
Sequence agaggcuggccgugaugaauuc
miRNA Species Homo sapiens
Regulation Mechanism miR-485-5p directly binds the FZD7 3'UTR. Overexpression of miR-485-5p repressed the luciferase activity of the luciferase reporter vector containing the FZD7 3'UTR, whereas miR-485-5p suppression caused the opposite effect. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Frizzled-7 receptor (FZD7) Target Info
FZD7_HUMAN
References  Top
REF 1 MicroRNA-27b suppresses Helicobacter pylori-induced gastric tumorigenesis through negatively regulating Frizzled7. Oncol Rep. 2016 Apr;35(4):2441-50.
REF 2 MicroRNA-27b inhibits cell proliferation in oral squamous cell carcinoma by targeting FZD7 and Wnt signaling pathway. Arch Oral Biol. 2017 Nov;83:92-96.
REF 3 Putative tumor suppressor miR-145 inhibits colon cancer cell growth by targeting oncogene Friend leukemia virus integration 1 gene. Cancer. 2011 Jan 1;117(1):86-95.
REF 4 MicroRNA-542-3p inhibits the growth of hepatocellular carcinoma cells by targeting FZD7/Wnt signaling pathway. Biochem Biophys Res Commun. 2017 Jan 1;482(1):100-105.
REF 5 MicroRNA-485-5p represses melanoma cell invasion and proliferation by suppressing Frizzled7. Biomed Pharmacother. 2017 Jun;90:303-310.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.