Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T49630 |
Target Info
|
| Target Name |
Lectin-like oxidized LDL receptor (OLR1) |
| Synonyms |
hLOX-1; Oxidized low-density lipoprotein receptor 1; Oxidized low-density lipoprotein receptor; Oxidised low density lipoprotein (Lectin-like) receptor 1; Ox-LDL receptor 1; Lectin-type oxidized LDL receptor 1; Lectin-type oxidized LDL receptor; Lectin-like oxidized low-density lipoprotein receptor-1; Lectin-like oxidized LDL receptor-1; Lectin-like oxidized LDL receptor 1; Lectin-like oxLDL receptor 1; LOX1; LOX-1; CLEC8A; C-type lectin domain family 8 member A |
| Target Type |
Clinical trial Target |
| Gene Name |
OLR1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-590-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gagcuuauucauaaaagugcag
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3)
|
Target Info
|
|
|
Lectin-like oxidized LDL receptor (OLR1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuaaugcuaaucgugauagggguu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-590-5p Inhibits Oxidized- LDL Induced Angiogenesis by Targeting LOX-1. Sci Rep. 2016 Mar 2;6:22607.
|
| REF 2 |
MicroRNA-155 silencing enhances inflammatory response and lipid uptake in oxidized low-density lipoprotein-stimulated human THP-1 macrophages. J Investig Med. 2010 Dec;58(8):961-7.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
