Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T56474 Target Info
Target Name Zinc finger protein A20 (TNFAIP3)
Synonyms Tumor necrosis factor, alpha-induced protein3; Tumor necrosis factor alpha-induced protein 3; TNF alpha-induced protein 3; Putative DNA-binding protein A20; Putative DNA binding protein A20; OTUD7C; OTU domain-containing protein 7C; A20
Target Type Literature-reported Target
Gene Name TNFAIP3
Biochemical Class Acyltransferase
UniProt ID
P21580
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism TNFAIP3 is a direct target of miR-125a and miR-125b,. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [3]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Regulation Mechanism TNFAIP3 was a target of miR-18a and the target site in the 3' UTR sequences is between 674 and 680. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism TNFAIP3 was a direct target of miR-29c. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-19a-5p miRNA Info
miRNA Mature AC
MIMAT0004490
Sequence aguuuugcauaguugcacuaca
miRNA Species Homo sapiens
Regulation Mechanism miR-19a, a colon tumor-enriched miRNA, regulates NF-KB by targeting TNFAIP3. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Zinc finger protein A20 (TNFAIP3) Target Info
TNAP3_HUMAN
References  Top
REF 1 MiR-125a regulates chemo-sensitivity to gemcitabine in human pancreatic cancer cells through targeting A20. Acta Biochim Biophys Sin (Shanghai). 2016 Feb;48(2):202-8.
REF 2 MicroRNAs miR-125a and miR-125b constitutively activate the NF-B pathway by targeting the tumor necrosis factor alpha-induced protein 3 (TNFAIP3, A20). Proc Natl Acad Sci U S A. 2012 May 15;109(20):7865-70.
REF 3 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 4 Uncovering Direct Targets of MiR-19a Involved in Lung Cancer Progression. PLoS One. 2015 Sep 14;10(9):e0137887.
REF 5 Let-7 miRNAs Modulate the Activation of NF-B by Targeting TNFAIP3 and Are Involved in the Pathogenesis of Lupus Nephritis. PLoS One. 2015 Jun 25;10(6):e0121256.
REF 6 Relevance of microRNA-18a and microRNA-199a-5p to hepatocellular carcinoma recurrence after living donor liver transplantation. Liver Transpl. 2016 May;22(5):665-76.
REF 7 Induction of miR-21 by retinoic acid in estrogen receptor-positive breast carcinoma cells: biological correlates and molecular targets. J Biol Chem. 2011 Feb 4;286(5):4027-42.
REF 8 miR-29c targets TNFAIP3, inhibits cell proliferation and induces apoptosis in hepatitis B virus-related hepatocellular carcinoma. Biochem Biophys Res Commun. 2011 Aug 5;411(3):586-92.
REF 9 miR-19a promotes colitis-associated colorectal cancer by regulating tumor necrosis factor alpha-induced protein 3-NF-B feedback loops. Oncogene. 2017 Jun 8;36(23):3240-3251.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.