The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
TNFAIP3 is a direct target of miR-125a and miR-125b,. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
2 |
qRT-PCR; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-19a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugugcaaaucuaugcaaaacuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
HITS-CLIP |
[3] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Adrenergic receptor beta-1 (ADRB1)
|
Target Info
|
|
Apoptosis signal-regulating kinase 1 (MAP3K5)
|
Target Info
|
|
miRNA Mature ID |
hsa-let-7e-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaggagguuguauaguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
Aurora kinase B (AURKB)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-18a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaggugcaucuagugcagauag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
TNFAIP3 was a target of miR-18a and the target site in the 3' UTR sequences is between 674 and 680. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcuuaucagacugauguuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[7] |
Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccaucugaaaucgguua
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
TNFAIP3 was a direct target of miR-29c. |
[8] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[8] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-19a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aguuuugcauaguugcacuaca
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-19a, a colon tumor-enriched miRNA, regulates NF-KB by targeting TNFAIP3. |
[9] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[9] |
Representative Target(s) Regulated by This miRNA |
B-cell translocation gene 1 protein (BTG1)
|
Target Info
|
|
Zinc finger protein A20 (TNFAIP3)
|
Target Info
|
|