Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T58970 Target Info
Target Name Extracellular signal-regulated kinase 2 (ERK2)
Synonyms PRKM2; PRKM1; P42-MAPK; P42 Mitogen-activated protein kinase; Mitogen-activated protein kinase 2; Mitogen-activated protein kinase 1; MAPK 2; MAPK 1; MAP kinase isoform p42; MAP kinase 2; MAP kinase 1; ERT1; ERK-2
Target Type Clinical trial Target
Gene Name MAPK1
Biochemical Class Kinase
UniProt ID
P28482
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-28-5p miRNA Info
miRNA Mature AC
MIMAT0000085
Sequence aaggagcucacagucuauugag
miRNA Species Homo sapiens
Regulation Mechanism MAPK1 was inhibited by miR-28. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-378a-3p miRNA Info
miRNA Mature AC
MIMAT0000732
Sequence acuggacuuggagucagaaggc
miRNA Species Homo sapiens
Regulation Mechanism MAPK1 was a target gene of miR-378 in GC cells and tumor-suppressive role of miR-378 might be achieved by the direct interaction with MAPK1. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Aromatase (CYP19A1) Target Info
CP19A_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism MAPK1 is a target for regulation by miR-132-3p. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [6]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Regulation Mechanism miR-335 directly targets the 3'UTR of MAPK1. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Regulation Mechanism miR-451 mediates cell migration, invasion, and epithelial-mesenchymal transition (EMT) by repressing the target gene ERK2, which is a component of the MAPK signaling pathway and is known to promote cancer metastasis. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-197-3p miRNA Info
miRNA Mature AC
MIMAT0000227
Sequence uucaccaccuucuccacccagc
miRNA Species Homo sapiens
Regulation Mechanism miR-197 influences the sensitivity of 5-FU treatment in a gastric cancer cell line by targeting MAPK1. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
References  Top
REF 1 miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45.
REF 2 The miRNA Pull Out Assay as a Method to Validate the miR-28-5p Targets Identified in Other Tumor Contexts in Prostate Cancer. Int J Genomics. 2017;2017:5214806.
REF 3 MiR-378 controls cardiac hypertrophy by combined repression of mitogen-activated protein kinase pathway factors. Circulation. 2013 May 28;127(21):2097-106.
REF 4 MiR-378 inhibits progression of human gastric cancer MGC-803 cells by targeting MAPK1 in vitro. Oncol Res. 2012;20(12):557-64.
REF 5 Rapid regulation of microRNA following induction of long-term potentiation in vivo. Front Mol Neurosci. 2014 Dec 9;7:98.
REF 6 miRNA-214 modulates radiotherapy response of non-small cell lung cancer cells through regulation of p38MAPK, apoptosis and senescence. Br J Cancer. 2012 Oct 9;107(8):1361-73.
REF 7 MiRNA-335 suppresses neuroblastoma cell invasiveness by direct targeting of multiple genes from the non-canonical TGF- signalling pathway. Carcinogenesis. 2012 May;33(5):976-85.
REF 8 High-Throughput Screening Identifies miR-451 as a Pleiotropic Modulator That Suppresses Gastric Cancer Metastasis. SLAS Technol. 2017 Apr;22(2):136-143.
REF 9 MicroRNA 97 reverses the drug resistance of fluorouracilnduced SGC7901 cells by targeting mitogenctivated protein kinase 1. Mol Med Rep. 2015 Oct;12(4):5019-25.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.