miRNA General Information
miRNA Mature ID hsa-miR-378a-3p
miRNA Stemloop AC MI0000786
miRNA Stemloop ID hsa-mir-378a
Sequence acuggacuuggagucagaaggc
TTD Target(s) Regulated by This miRNA Aromatase (CYP19A1) Successful Target Target Info [1]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [2]
Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [3]
Progesterone receptor (PGR) Successful Target Target Info [4]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [2]
Extracellular signal-regulated kinase 2 (ERK2) Clinical trial Target Target Info [5]
Transforming growth factor beta 2 (TGFB2) Clinical trial Target Target Info [6]
Tumor suppressor candidate 2 (TUSC2) Clinical trial Target Target Info [7]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [8]
Kinase suppressor of Ras-1 (KSR1) Literature-reported Target Target Info [9]
Protein(s) Regulated by This miRNA Musculin Regulated Protein [10]
N-acetylgalactosaminyltransferase 7 Regulated Protein [11]
Nephronectin Regulated Protein [11]
Protein Tob2 Regulated Protein [12]
Protein Wnt-10a Regulated Protein [13]
Runt-related transcription factor 1 Regulated Protein [14]
Transcriptional activator GLI3 Regulated Protein [15]
Vesicle transport protein GOT1A Regulated Protein [16]
Vimentin Regulated Protein [17]
References
REF 1 Micro-RNA378 (miR-378) regulates ovarian estradiol production by targeting aromatase. Endocrinology. 2011 Oct;152(10):3941-51.
REF 2 MicroRNA-195 and microRNA-378 mediate tumor growth suppression by epigenetical regulation in gastric cancer. Gene. 2013 Apr 15;518(2):351-9.
REF 3 Mechanism of growth inhibition by MicroRNA 145: the role of the IGF-I receptor signaling pathway. J Cell Physiol. 2009 Aug;220(2):485-91.
REF 4 Progesterone receptor expression in granulosa cells is suppressed by microRNA-378-3p. Mol Cell Endocrinol. 2015 Jan 5;399:95-102.
REF 5 MiR-378 inhibits progression of human gastric cancer MGC-803 cells by targeting MAPK1 in vitro. Oncol Res. 2012;20(12):557-64.
REF 6 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
REF 7 MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression. Proc Natl Acad Sci U S A. 2007 Dec 18;104(51):20350-5.
REF 8 Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79.
REF 9 MiR-378 controls cardiac hypertrophy by combined repression of mitogen-activated protein kinase pathway factors. Circulation. 2013 May 28;127(21):2097-106.
REF 10 MicroRNA-378 targets the myogenic repressor MyoR during myoblast differentiation.J Biol Chem. 2011 Jun 3;286(22):19431-8.
REF 11 MicroRNA miR-378 regulates nephronectin expression modulating osteoblast differentiation by targeting GalNT-7.PLoS One. 2009 Oct 21;4(10):e7535.
REF 12 Myc/miR-378/TOB2/cyclin D1 functional module regulates oncogenic transformation. Oncogene. 2011 May 12;30(19):2242-51.
REF 13 Activation of Hepatic Stellate Cells is Inhibited by microRNA-378a-3p via Wnt10a. Cell Physiol Biochem. 2016;39(6):2409-2420.
REF 14 MicroRNA-378-mediated suppression of Runx1 alleviates the aggressive phenotype of triple-negative MDA-MB-231 human breast cancer cells.Tumour Biol. 2016 Jul;37(7):8825-39.
REF 15 MicroRNA-378 limits activation of hepatic stellate cells and liver fibrosis by suppressing Gli3 expression.Nat Commun. 2016 Mar 22;7:10993.
REF 16 miR-378a-3p modulates tamoxifen sensitivity in breast cancer MCF-7 cells through targeting GOLT1A.Sci Rep. 2015 Aug 10;5:13170.
REF 17 MiR-378 is an independent prognostic factor and inhibits cell growth and invasion in colorectal cancer.BMC Cancer. 2014 Feb 20;14:109.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.