miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-378a-3p | ||||
miRNA Stemloop AC | MI0000786 | ||||
miRNA Stemloop ID | hsa-mir-378a | ||||
Sequence | acuggacuuggagucagaaggc | ||||
TTD Target(s) Regulated by This miRNA | Aromatase (CYP19A1) | Successful Target | Target Info | [1] | |
Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [2] | ||
Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [3] | ||
Progesterone receptor (PGR) | Successful Target | Target Info | [4] | ||
Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [2] | ||
Extracellular signal-regulated kinase 2 (ERK2) | Clinical trial Target | Target Info | [5] | ||
Transforming growth factor beta 2 (TGFB2) | Clinical trial Target | Target Info | [6] | ||
Tumor suppressor candidate 2 (TUSC2) | Clinical trial Target | Target Info | [7] | ||
Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [8] | ||
Kinase suppressor of Ras-1 (KSR1) | Literature-reported Target | Target Info | [9] | ||
Protein(s) Regulated by This miRNA | Musculin | Regulated Protein | [10] | ||
N-acetylgalactosaminyltransferase 7 | Regulated Protein | [11] | |||
Nephronectin | Regulated Protein | [11] | |||
Protein Tob2 | Regulated Protein | [12] | |||
Protein Wnt-10a | Regulated Protein | [13] | |||
Runt-related transcription factor 1 | Regulated Protein | [14] | |||
Transcriptional activator GLI3 | Regulated Protein | [15] | |||
Vesicle transport protein GOT1A | Regulated Protein | [16] | |||
Vimentin | Regulated Protein | [17] | |||
References | |||||
REF 1 | Micro-RNA378 (miR-378) regulates ovarian estradiol production by targeting aromatase. Endocrinology. 2011 Oct;152(10):3941-51. | ||||
REF 2 | MicroRNA-195 and microRNA-378 mediate tumor growth suppression by epigenetical regulation in gastric cancer. Gene. 2013 Apr 15;518(2):351-9. | ||||
REF 3 | Mechanism of growth inhibition by MicroRNA 145: the role of the IGF-I receptor signaling pathway. J Cell Physiol. 2009 Aug;220(2):485-91. | ||||
REF 4 | Progesterone receptor expression in granulosa cells is suppressed by microRNA-378-3p. Mol Cell Endocrinol. 2015 Jan 5;399:95-102. | ||||
REF 5 | MiR-378 inhibits progression of human gastric cancer MGC-803 cells by targeting MAPK1 in vitro. Oncol Res. 2012;20(12):557-64. | ||||
REF 6 | Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32. | ||||
REF 7 | MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression. Proc Natl Acad Sci U S A. 2007 Dec 18;104(51):20350-5. | ||||
REF 8 | Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79. | ||||
REF 9 | MiR-378 controls cardiac hypertrophy by combined repression of mitogen-activated protein kinase pathway factors. Circulation. 2013 May 28;127(21):2097-106. | ||||
REF 10 | MicroRNA-378 targets the myogenic repressor MyoR during myoblast differentiation.J Biol Chem. 2011 Jun 3;286(22):19431-8. | ||||
REF 11 | MicroRNA miR-378 regulates nephronectin expression modulating osteoblast differentiation by targeting GalNT-7.PLoS One. 2009 Oct 21;4(10):e7535. | ||||
REF 12 | Myc/miR-378/TOB2/cyclin D1 functional module regulates oncogenic transformation. Oncogene. 2011 May 12;30(19):2242-51. | ||||
REF 13 | Activation of Hepatic Stellate Cells is Inhibited by microRNA-378a-3p via Wnt10a. Cell Physiol Biochem. 2016;39(6):2409-2420. | ||||
REF 14 | MicroRNA-378-mediated suppression of Runx1 alleviates the aggressive phenotype of triple-negative MDA-MB-231 human breast cancer cells.Tumour Biol. 2016 Jul;37(7):8825-39. | ||||
REF 15 | MicroRNA-378 limits activation of hepatic stellate cells and liver fibrosis by suppressing Gli3 expression.Nat Commun. 2016 Mar 22;7:10993. | ||||
REF 16 | miR-378a-3p modulates tamoxifen sensitivity in breast cancer MCF-7 cells through targeting GOLT1A.Sci Rep. 2015 Aug 10;5:13170. | ||||
REF 17 | MiR-378 is an independent prognostic factor and inhibits cell growth and invasion in colorectal cancer.BMC Cancer. 2014 Feb 20;14:109. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.