Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T60930 Target Info
Target Name Insulin-like growth factor-I (IGF1)
Synonyms SomatomedinC; Somatomedin-C; Mechano growth factor; Insulin-like growth factor I; IGFI; IGF-I
Target Type Clinical trial Target
Gene Name IGF1
UniProt ID
P05019
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism IGF1 as a target for let-7 and downregulation of let-7 resulted in upregulation of IGF1 during the early stage of differentiation from spermatogonia to primary spermatocytes. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism miR-130b-3p exerted its role on MRC5 activities by directly targeting the expression of IGF-1. [3]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay; Western Blot [3]
2 Western Blot; Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-18b-5p miRNA Info
miRNA Mature AC
MIMAT0001412
Sequence uaaggugcaucuagugcaguuag
miRNA Species Homo sapiens
Regulation Mechanism miR-18b regulates IGF-1 by binding its 3'UTR. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-28-5p miRNA Info
miRNA Mature AC
MIMAT0000085
Sequence aaggagcucacagucuauugag
miRNA Species Homo sapiens
Regulation Mechanism miR-28-5p as a critical regulator of IGF1 mRNA translation function, down-regualted miR-28-5p in HCC was associated with tumor growth through PI3K/AKT pathway by targeting IGF1. [8]
Evidence Score (E-score) 2 +
1 ELISA; RT-PCR [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-483-3p miRNA Info
miRNA Mature AC
MIMAT0002173
Sequence ucacuccucuccucccgucuu
miRNA Species Homo sapiens
Regulation Mechanism miR-483-3p is a repressor of the IGF-1 gene by binding sites in the IGF-1 3' UTR. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Western Blot [10]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-let-7i-5p miRNA Info
miRNA Mature AC
MIMAT0000415
Sequence ugagguaguaguuugugcuguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of let-7i induced autophagy by targeting IGF1R. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
Bone morphogenetic protein 4 (BMP4) Target Info
BMP4_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Regulation Mechanism miR-26b increases Abeta production by targeting IGF. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; ELISA; GFP Reporter Assay; Immunoblot; Immunoprecipitation; Western Blot [13]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29a was repressed by androgen system and inversely inhibited a rexpression by targeting IGF1 and CDC42/p85-p53 pathways. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism IGF1R was a potential target of miR-98. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-190a-5p miRNA Info
miRNA Mature AC
MIMAT0000458
Sequence ugauauguuugauauauuaggu
miRNA Species Homo sapiens
Regulation Mechanism miR-190 directly targets IGF1. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [16]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Insulin-like growth factor-I (IGF1) Target Info
IGF1_HUMAN
miRNA Mature ID hsa-miR-603 miRNA Info
miRNA Mature AC
MIMAT0003271
Sequence cacacacugcaauuacuuuugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Insulin-like growth factor-I (IGF1) Target Info
IGF1_HUMAN
miRNA Mature ID hsa-miR-299-3p miRNA Info
miRNA Mature AC
MIMAT0000687
Sequence uaugugggaugguaaaccgcuu
miRNA Species Homo sapiens
Regulation Mechanism Knockdown of hsa-miR-299-3p released the suppression of IGF1 which indicating IGF1 as potential target of hsa-miR-299-3p. [18]
Evidence Score (E-score) 1 +
1 qRT-PCR [18]
Representative Target(s) Regulated by This miRNA Insulin-like growth factor-I (IGF1) Target Info
IGF1_HUMAN
References  Top
REF 1 Upstream and downstream mechanisms for the promoting effects of IGF-1 on differentiation of spermatogonia to primary spermatocytes. Life Sci. 2014 Apr 17;101(1-2):49-55.
REF 2 IGF1/IGF1R and microRNA let-7e down-regulate each other and modulate proliferation and migration of colorectal cancer cells. Cell Cycle. 2018;17(10):1212-1219.
REF 3 miR-130b-3p Modulates Epithelial-Mesenchymal Crosstalk in Lung Fibrosis by Targeting IGF-1. PLoS One. 2016 Mar 8;11(3):e0150418.
REF 4 Down-regulation of long non-coding RNA MEG3 suppresses osteogenic differentiation of periodontal ligament stem cells (PDLSCs) through miR-27a-3p/IG... Aging (Albany NY). 2019 Aug 9;11(15):5334-5350.
REF 5 MiR-18b suppresses high-glucose-induced proliferation in HRECs by targeting IGF-1/IGF1R signaling pathways. Int J Biochem Cell Biol. 2016 Apr;73:41-52.
REF 6 microRNA-18b modulates insulin-like growth factor-1 expression in deer antler cell proliferation by directly targeting its 3' untranslated region. DNA Cell Biol. 2015 Apr;34(4):282-9.
REF 7 Decreased levels of miR-28-5p and miR-361-3p and increased levels of insulin-like growth factor 1 mRNA in mononuclear cells from patients with here... Can J Physiol Pharmacol. 2019 Jun;97(6):562-569.
REF 8 Down-regulated miR-28-5p in human hepatocellular carcinoma correlated with tumor proliferation and migration by targeting insulin-like growth factor-1 (IGF-1). Mol Cell Biochem. 2015 Oct;408(1-2):283-93.
REF 9 IGF-1 promotes the development and cytotoxic activity of human NK cells. Nat Commun. 2013;4:1479.
REF 10 miR-483-3p regulates acute myocardial infarction by transcriptionally repressing insulin growth factor 1 expression. Mol Med Rep. 2018 Mar;17(3):4785-4790.
REF 11 MicroRNA let-7i induced autophagy to protect T cell from apoptosis by targeting IGF1R. Biochem Biophys Res Commun. 2014 Oct 31;453(4):728-34.
REF 12 MicroRNA-26b is upregulated in a double transgenic mouse model of Alzheimer's disease and promotes the expression of amyloid- by targeting insulin-like growth factor 1. Mol Med Rep. 2016 Mar;13(3):2809-14.
REF 13 A novel oncogenic mechanism in Ewing sarcoma involving IGF pathway targeting by EWS/Fli1-regulated microRNAs. Oncogene. 2011 Dec 8;30(49):4910-20.
REF 14 An androgen receptor-microrna-29a regulatory circuitry in mouse epididymis. J Biol Chem. 2013 Oct 11;288(41):29369-81.
REF 15 miR-98 suppresses tumor cell growth and metastasis by targeting IGF1R in oral squamous cell carcinoma. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12252-9.
REF 16 The synergistic regulation of VEGF-mediated angiogenesis through miR-190 and target genes. RNA. 2014 Aug;20(8):1328-36.
REF 17 The Functional Variant in the 3'UTR of IGF1 with the Risk of Gastric Cancer in a Chinese Population. Cell Physiol Biochem. 2015;36(3):884-92.
REF 18 MicroRNA 299-3p modulates replicative senescence in endothelial cells. Physiol Genomics. 2013 Apr 1;45(7):256-67.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.