Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T78181 |
Target Info
|
Target Name |
MTOR complex 2 (RICTOR) |
Synonyms |
hAVO3; Rapamycin-insensitive companion of mTOR; KIAA1999; AVO3 homolog |
Target Type |
Literature-reported Target |
Gene Name |
RICTOR |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-let-7c-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaguagguuguaugguu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
let-7 targeted RICTOR miR. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
Caspase-3 (CASP3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcagugucuuagcugguugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Overexpression of miR-34a resulted in a significant down-regulation of RICTOR at protein level indicating it to be a functional target of miR-34a. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Androgen receptor (AR)
|
Target Info
|
|
References |
Top |
REF 1 |
microRNA-mediated regulation of mTOR complex components facilitates discrimination between activation and anergy in CD4 T cells. J Exp Med. 2014 Oct 20;211(11):2281-95.
|
REF 2 |
Tumor suppressive miRNA-34a suppresses cell proliferation and tumor growth of glioma stem cells by targeting Akt and Wnt signaling pathways. FEBS Open Bio. 2014 May 22;4:485-95.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.