Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T78181 Target Info
Target Name MTOR complex 2 (RICTOR)
Synonyms hAVO3; Rapamycin-insensitive companion of mTOR; KIAA1999; AVO3 homolog
Target Type Literature-reported Target
Gene Name RICTOR
UniProt ID
Q6R327
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism let-7 targeted RICTOR miR. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-34a resulted in a significant down-regulation of RICTOR at protein level indicating it to be a functional target of miR-34a. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 microRNA-mediated regulation of mTOR complex components facilitates discrimination between activation and anergy in CD4 T cells. J Exp Med. 2014 Oct 20;211(11):2281-95.
REF 2 Tumor suppressive miRNA-34a suppresses cell proliferation and tumor growth of glioma stem cells by targeting Akt and Wnt signaling pathways. FEBS Open Bio. 2014 May 22;4:485-95.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.