Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T86052 Target Info
Target Name Telomerase reverse transcriptase (TERT)
Synonyms Telomerase-associated protein 2; Telomerase catalytic subunit; TRT; TP2; TCS1; HEST2; EST2
Target Type Clinical trial Target
Gene Name TERT
Biochemical Class Kinase
UniProt ID
O14746
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-3064-5p miRNA Info
miRNA Mature AC
MIMAT0019864
Sequence ucuggcuguuguggugugcaa
miRNA Species Homo sapiens
Regulation Mechanism miR-3064 acts directly to suppress hTERT expression in OC cells. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Telomerase reverse transcriptase (TERT) Target Info
TERT_HUMAN
miRNA Mature ID hsa-miR-346 miRNA Info
miRNA Mature AC
MIMAT0000773
Sequence ugucugcccgcaugccugccucu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
Interleukin-18 (IL18) Target Info
IL18_HUMAN
miRNA Mature ID hsa-miR-422a miRNA Info
miRNA Mature AC
MIMAT0001339
Sequence acuggacuuagggucagaaggc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Ecto-5'-nucleotidase (CD73) Target Info
5NTD_HUMAN
Forkhead box protein Q1 (FOXQ1) Target Info
FOXQ1_HUMAN
miRNA Mature ID hsa-miR-532-5p miRNA Info
miRNA Mature AC
MIMAT0002888
Sequence caugccuugaguguaggaccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-532 acts directly to suppress hTERT expression in OC cells. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
Fatty acid synthase (FASN) Target Info
FAS_HUMAN
miRNA Mature ID hsa-miR-1207-5p miRNA Info
miRNA Mature AC
MIMAT0005871
Sequence uggcagggaggcugggagggg
miRNA Species Homo sapiens
Regulation Mechanism miR-1207-5p is determined to be hTERT suppressors in gastric cancer. [5]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Macrophage colony-stimulating factor 1 (CSF1) Target Info
CSF1_HUMAN
Signal transducer and activator of transcription 6 (STAT6) Target Info
STAT6_HUMAN
miRNA Mature ID hsa-miR-1182 miRNA Info
miRNA Mature AC
MIMAT0005827
Sequence gagggucuugggagggaugugac
miRNA Species Homo sapiens
Regulation Mechanism miR-1182 inhibited gastric cancer proliferation and migration by targeting the open reading frame of hTERT. [6]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Telomerase reverse transcriptase (TERT) Target Info
TERT_HUMAN
miRNA Mature ID hsa-miR-1266-5p miRNA Info
miRNA Mature AC
MIMAT0005920
Sequence ccucagggcuguagaacagggcu
miRNA Species Homo sapiens
Regulation Mechanism miR-1266-5p is determined to be hTERT suppressors in gastric cancer. [5]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Telomerase reverse transcriptase (TERT) Target Info
TERT_HUMAN
References  Top
REF 1 MicroRNA-532 and microRNA-3064 inhibit cell proliferation and invasion by acting as direct regulators of human telomerase reverse transcriptase in ovarian cancer. PLoS One. 2017 Mar 14;12(3):e0173912.
REF 2 Role of microRNAs Located on Chromosome Arm 10q in Malignant Gliomas. Brain Pathol. 2016 May;26(3):344-58.
REF 3 miR-346 and miR-138 competitively regulate hTERT in GRSF1- and AGO2-dependent manners, respectively. Sci Rep. 2015 Oct 28;5:15793.
REF 4 Screening and preliminary validation of miRNAs with the regulation of hTERT in colorectal cancer. Oncol Rep. 2015 Jun;33(6):2728-36.
REF 5 miR-1207-5p and miR-1266 suppress gastric cancer growth and invasion by targeting telomerase reverse transcriptase. Cell Death Dis. 2014 Jan 30;5:e1034.
REF 6 miR-1182 attenuates gastric cancer proliferation and metastasis by targeting the open reading frame of hTERT. Cancer Lett. 2015 May 1;360(2):151-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.