Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T86702 Target Info
Target Name Matrix metalloproteinase-3 (MMP-3)
Synonyms Transin-1; Stromelysin-1; STMY1; SL-1; MMP-3
Target Type Patented-recorded Target
Gene Name MMP3
Biochemical Class Peptidase
UniProt ID
P08254
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-204-5p by mature miRNA transfection resulted in the changed mRNA level of target MMP3. [2]
Evidence Score (E-score) 2 +
1 Immunoblot [1]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-93 represses MMP3 expression by targeting 3'UTR directly. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-93-3p miRNA Info
miRNA Mature AC
MIMAT0004509
Sequence acugcugagcuagcacuucccg
miRNA Species Homo sapiens
Regulation Mechanism miR-93 directly targeted the MMP3 3'UTR. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-3 (MMP-3) Target Info
MMP3_HUMAN
References  Top
REF 1 MiR-204 down-regulation elicited perturbation of a gene target signature common to human cholangiocarcinoma and gastric cancer. Oncotarget. 2017 May 2;8(18):29540-29557.
REF 2 Network modeling identifies molecular functions targeted by miR-204 to suppress head and neck tumor metastasis. PLoS Comput Biol. 2010 Apr 1;6(4):e1000730.
REF 3 Down regulation of MiR-93 contributes to endometriosis through targeting MMP3 and VEGFA. Am J Cancer Res. 2015 Apr 15;5(5):1706-17.
REF 4 MicroRNA-93 regulates collagen loss by targeting MMP3 in human nucleus pulposus cells. Cell Prolif. 2015 Jun;48(3):284-92.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.