Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16180 Target Info
Target Name Transcription factor E2F2 (E2F2)
Synonyms E2F-2
Target Type Literature-reported Target
Gene Name E2F2
UniProt ID
Q14209
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Microarray; qRT-PCR [2]
3 Reporter Assay [3]
4 Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism E2 induced the expression of miR-21 reduced the levels of E2F2 protein. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Northern Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-214-5p miRNA Info
miRNA Mature AC
MIMAT0004564
Sequence ugccugucuacacuugcugugc
miRNA Species Homo sapiens
Regulation Mechanism miR-214 directly inhibited E2F2 regulators. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [6]
2 Western Blot [7]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclin-dependent kinase 3 (CDK3) Target Info
CDK3_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Regulation Mechanism E2F2 is a direct target of Let-7b. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-24-3p miRNA Info
miRNA Mature AC
MIMAT0000080
Sequence uggcucaguucagcaggaacag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-24-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target E2F2. [5]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism E2F2 was a direct target of miR-31 and E2F2 expression was inversely associated with miR-31 expression. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Immunohistochemistry [8]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism E2 induced the expression of miR-98 reduced the levels of E2F2 protein. [5]
Evidence Score (E-score) 1 +
1 Northern Blot; Western Blot; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-31-3p miRNA Info
miRNA Mature AC
MIMAT0004504
Sequence ugcuaugccaacauauugccau
miRNA Species Homo sapiens
Regulation Mechanism E2F2 was direct mRNA targets of miR-31. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Nectin cell adhesion molecule 4 (NECTIN4) Target Info
NECT4_HUMAN
Transcription factor E2F2 (E2F2) Target Info
E2F2_HUMAN
References  Top
REF 1 miR-155 regulates the proliferation and invasion of clear cell renal cell carcinoma cells by targeting E2F2. Oncotarget. 2016 Apr 12;7(15):20324-37.
REF 2 Identification of putative pathogenic microRNA and its downstream targets in anaplastic lymphoma kinase-negative anaplastic large cell lymphoma. Hum Pathol. 2014 Oct;45(10):1995-2005.
REF 3 Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
REF 4 Reticuloendotheliosis virus strain T induces miR-155, which targets JARID2 and promotes cell survival. J Virol. 2009 Dec;83(23):12009-17.
REF 5 Estradiol-regulated microRNAs control estradiol response in breast cancer cells. Nucleic Acids Res. 2009 Aug;37(14):4850-61.
REF 6 miR-214/199a/199a* cluster levels predict poor survival in hepatocellular carcinoma through interference with cell-cycle regulators. Oncotarget. 2016 Jan 5;7(1):929-45.
REF 7 Let-7b inhibits the malignant behavior of glioma cells and glioma stem-like cells via downregulation of E2F2. J Physiol Biochem. 2016 Dec;72(4):733-744.
REF 8 Downregulated miR-31 level associates with poor prognosis of gastric cancer and its restoration suppresses tumor cell malignant phenotypes by inhibiting E2F2. Oncotarget. 2016 Jun 14;7(24):36577-36589.
REF 9 miR-31 and miR-17-5p levels change during transformation of follicular lymphoma. Hum Pathol. 2016 Apr;50:118-26.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.