Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T28887 Target Info
Target Name Histone deacetylase 8 (HDAC8)
Synonyms Histone deacetylase-8; HDACL1; HD8; CDA07
Target Type Clinical trial Target
Gene Name HDAC8
Biochemical Class Carbon-nitrogen hydrolase
UniProt ID
Q9BY41
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-455-3p miRNA Info
miRNA Mature AC
MIMAT0004784
Sequence gcaguccaugggcauauacac
miRNA Species Homo sapiens
Regulation Mechanism miR-455-3p modulates HDAC8 expression by binding to the 3'UTR of respective sequences. [1]
Evidence Score (E-score) 2 +
1 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; RT-PCR; Western Blot; Immunohistochemistry [2]
Representative Target(s) Regulated by This miRNA Eukaryotic initiation factor 4E (EIF4E) Target Info
IF4E_HUMAN
Histone deacetylase 2 (HDAC2) Target Info
HDAC2_HUMAN
miRNA Mature ID hsa-miR-216b-5p miRNA Info
miRNA Mature AC
MIMAT0004959
Sequence aaaucucugcaggcaaauguga
miRNA Species Homo sapiens
Regulation Mechanism miR-216b functions as a tumor suppressor by targeting HDAC8. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
References  Top
REF 1 MicroRNA-455-3p modulates cartilage development and degeneration through modification of histone H3 acetylation. Biochim Biophys Acta. 2016 Dec;1863(12):2881-2891.
REF 2 MiR-455-3p inhibits the degenerate process of chondrogenic differentiation through modification of DNA methylation. Cell Death Dis. 2018 May 1;9(5):537.
REF 3 MicroRNA-216b is Down-Regulated in Human Gastric Adenocarcinoma and Inhibits Proliferation and Cell Cycle Progression by Targeting Oncogene HDAC8. Target Oncol. 2016 Apr;11(2):197-207.
REF 4 miR-449a targets HDAC-1 and induces growth arrest in prostate cancer. Oncogene. 2009 Apr 9;28(14):1714-24.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.