Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T37961 Target Info
Target Name PAK-1 protein kinase (PAK1)
Synonyms p65-PAK; p21-activated kinase 1; Serine/threonine-protein kinase PAK 1; PAK-1; Alpha-PAK
Target Type Literature-reported Target
Gene Name PAK1
Biochemical Class Kinase
UniProt ID
Q13153
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism miRNA-221 directly targets PAK1. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-377-3p miRNA Info
miRNA Mature AC
MIMAT0000730
Sequence aucacacaaaggcaacuuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-377 reduced luciferase production in the standard luciferase reporter assay in which the 3 -UTR of PAK1 was inserted in a pGL3R vector. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Regulation Mechanism PAK1 is direct target of miR-34b. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-7-5p miRNA Info
miRNA Mature AC
MIMAT0000252
Sequence uggaagacuagugauuuuguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-7-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target PAK1. [3]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Activated CDC42 kinase 1 (ACK-1) Target Info
ACK1_HUMAN
Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism miR-98 direct inhibits expression of PAK1 via its 3'UTR. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
References  Top
REF 1 Increased expression of microRNA-221 inhibits PAK1 in endothelial progenitor cells and impairs its function via c-Raf/MEK/ERK pathway. Biochem Biophys Res Commun. 2013 Feb 15;431(3):404-8.
REF 2 The investigation of miR-221-3p and PAK1 gene expressions in breast cancer cell lines. Gene. 2015 Jan 25;555(2):377-81.
REF 3 MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J. 2008 Dec;22(12):4126-35.
REF 4 MicroRNA-377 suppresses cell proliferation and invasion by inhibiting TIAM1 expression in hepatocellular carcinoma. PLoS One. 2015 Mar 4;10(3):e0117714.
REF 5 Sirolimus induces apoptosis and reverses multidrug resistance in human osteosarcoma cells in vitro via increasing microRNA-34b expression. Acta Pharmacol Sin. 2016 Apr;37(4):519-29.
REF 6 MiR-98 inhibits cell proliferation and invasion of non-small cell carcinoma lung cancer by targeting PAK1. Int J Clin Exp Med. 2015 Nov 15;8(11):20135-45.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.