Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51425 Target Info
Target Name Vascular endothelial growth factor C (VEGFC)
Synonyms Vascular endothelial growth factor-related protein; VRP; VEGF-C; Flt4-L; Flt4 ligand
Target Type Clinical trial Target
Gene Name VEGFC
Biochemical Class Growth factor
UniProt ID
P49767
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-27b suppressed migration, proliferation activity, and tube formation in HUVECs by repressing VEGF-C secretion in gastric cancer cells. [2]
Evidence Score (E-score) 2 +
1 ELISA; Immunofluorescence; Microarray; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 ELISA; Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-122 repressed VEGFC, indicating miR-122 directly suppresses VEGFC. [3]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
References  Top
REF 1 miRNA-27b targets vascular endothelial growth factor C to inhibit tumor progression and angiogenesis in colorectal cancer. PLoS One. 2013 Apr 12;8(4):e60687.
REF 2 MicroRNA-27b, microRNA-101 and microRNA-128 inhibit angiogenesis by down-regulating vascular endothelial growth factor C expression in gastric cancers. Oncotarget. 2015 Nov 10;6(35):37458-70.
REF 3 MiR-122 targets VEGFC in bladder cancer to inhibit tumor growth and angiogenesis. Am J Transl Res. 2016 Jul 15;8(7):3056-66.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.