Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T56697 Target Info
Target Name Dickkopf-related protein 1 (DKK1)
Synonyms hDkk1; hDkk-1; UNQ492/PRO1008; Dkk1; Dkk-1; Dickkopfrelated protein 1; Dickkopf1; Dickkopf-1
Target Type Clinical trial Target
Gene Name DKK1
Biochemical Class Dickkopf protein
UniProt ID
O94907
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism Dikkopf-1(Dkk1) is a direct target of miR-29a. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-29a-5p miRNA Info
miRNA Mature AC
MIMAT0004503
Sequence acugauuucuuuugguguucag
miRNA Species Homo sapiens
Regulation Mechanism miR-29a regulates TNFA mediated bone loss mainly by targeting DKK1 thus activating the Wnt/b-catenin pathway. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Regulation Mechanism miR-373-3p overexpression markedly reduced the expression of DKK1 in two TSCC cell lines. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
2 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism DKK1 gene is directly regulated by miR-152. [6]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism Dkk-1 is a direct target of miR-31. [7]
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Regulation Mechanism DKK1 is directly targeted by miR-372. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
miRNA Mature ID hsa-miR-371a-3p miRNA Info
miRNA Mature AC
MIMAT0000723
Sequence aagugccgccaucuuuugagugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
miRNA Mature ID hsa-miR-493-3p miRNA Info
miRNA Mature AC
MIMAT0003161
Sequence ugaaggucuacugugugccagg
miRNA Species Homo sapiens
Regulation Mechanism miR-493 directly targeted and downregulated DKK1 expression. [9]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
ERK activator kinase 7 (MAP2K7) Target Info
MP2K7_HUMAN
miRNA Mature ID hsa-miR-501-5p miRNA Info
miRNA Mature AC
MIMAT0002872
Sequence aauccuuugucccugggugaga
miRNA Species Homo sapiens
Regulation Mechanism miR-501-5p directly targeted and suppressed multiple repressors of the wnt/B-catenin signaling cascade, including DKK1. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
References  Top
REF 1 miR-29 modulates Wnt signaling in human osteoblasts through a positive feedback loop. J Biol Chem. 2010 Aug 13;285(33):25221-31.
REF 2 Altered expression of microRNAs targeting Dkk-1 in peripheral blood mononuclear cells of patients with ankylosing spondylitis. Cent Eur J Immunol. 2019;44(1):59-64.
REF 3 miR-29a modulates tumor necrosis factor--induced osteogenic inhibition by targeting Wnt antagonists. Dev Growth Differ. 2015 Apr;57(3):264-73.
REF 4 -Catenin/LEF1 transactivates the microRNA-371-373 cluster that modulates the Wnt/-catenin-signaling pathway. Oncogene. 2012 Jun 14;31(24):2968-78.
REF 5 miR-373-3p Targets DKK1 to Promote EMT-Induced Metastasis via the Wnt/-Catenin Pathway in Tongue Squamous Cell Carcinoma. Biomed Res Int. 2017;2017:6010926.
REF 6 Downregulation of MicroRNA-152 contributes to high expression of DKK1 in multiple myeloma. RNA Biol. 2015;12(12):1314-22.
REF 7 Cigarette smoke induces C/EBP--mediated activation of miR-31 in normal human respiratory epithelia and lung cancer cells. PLoS One. 2010 Oct 29;5(10):e13764.
REF 8 MicroRNA-335-5p inhibits osteoblast apoptosis induced by high glucose. Mol Med Rep. 2016 May;13(5):4108-12.
REF 9 miR-493 mediated DKK1 down-regulation confers proliferation, invasion and chemo-resistance in gastric cancer cells. Oncotarget. 2016 Feb 9;7(6):7044-54.
REF 10 Upregulation of miR-501-5p activates the wnt/-catenin signaling pathway and enhances stem cell-like phenotype in gastric cancer. J Exp Clin Cancer Res. 2016 Nov 15;35(1):177.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.