Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T57700 Target Info
Target Name Tyrosine-protein kinase Kit (KIT)
Synonyms v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog; p145 c-kit; Proto-oncogene tyrosine-protein kinase Kit; Proto-oncogene c-Kit; Piebald trait protein; PBT; Mast/stem cell growth factor receptor Kit; CD117 antigen; CD117; C-kit
Target Type Successful Target
Gene Name KIT
Biochemical Class Kinase
UniProt ID
P10721
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-221-3p by mature miRNA transfection resulted in the decreased protein level of target KIT. [3]
Evidence Score (E-score) 8 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Northern Blot; qRT-PCR; Western Blot [5]
6 qRT-PCR; Western Blot [6]
7 qRT-PCR; Western Blot [7]
8 Reporter Assay; Microarray [8]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-222-3p by mature miRNA transfection resulted in the decreased protein level of target KIT. [3]
Evidence Score (E-score) 6 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; qRT-PCR; Microarray; Western Blot [9]
5 Northern Blot; qRT-PCR; Western Blot [5]
6 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-193b-3p miRNA Info
miRNA Mature AC
MIMAT0002819
Sequence aacuggcccucaaagucccgcu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [10]
2 PAR-CLIP [11]
Representative Target(s) Regulated by This miRNA DNA repair protein RAD51 homolog 1 (RAD51) Target Info
RAD51_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism CD117 is indeed a direct target of miR-34a-5p and may play roles in OS drug resistance. [12]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [12]
2 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
MIMAT0002809
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Northern Blot; Western Blot [5]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
S10AC_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-199b-5p miRNA Info
miRNA Mature AC
MIMAT0000263
Sequence cccaguguuuagacuaucuguuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [14]
Representative Target(s) Regulated by This miRNA Epithelial discoidin domain receptor 1 (DDR1) Target Info
DDR1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [15]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [15]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-221 and -222 pathway controls melanoma progression. Expert Rev Anticancer Ther. 2008 Nov;8(11):1759-65.
REF 2 MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer. Oncogene. 2008 Jun 19;27(27):3845-55.
REF 3 MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation. Proc Natl Acad Sci U S A. 2005 Dec 13;102(50):18081-6.
REF 4 Induction of microRNA-221 by platelet-derived growth factor signaling is critical for modulation of vascular smooth muscle phenotype. J Biol Chem. 2009 Feb 6;284(6):3728-38.
REF 5 The role of microRNA genes in papillary thyroid carcinoma. Proc Natl Acad Sci U S A. 2005 Dec 27;102(52):19075-80.
REF 6 MicroRNA-dependent regulation of cKit in cutaneous melanoma. Biochem Biophys Res Commun. 2009 Feb 13;379(3):790-4.
REF 7 The promyelocytic leukemia zinc finger-microRNA-221/-222 pathway controls melanoma progression through multiple oncogenic mechanisms. Cancer Res. 2008 Apr 15;68(8):2745-54.
REF 8 miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A. 2010 Jan 5;107(1):264-9.
REF 9 MiR-17-92 and miR-221/222 cluster members target KIT and ETV1 in human gastrointestinal stromal tumours. Br J Cancer. 2013 Sep 17;109(6):1625-35.
REF 10 STAT5-regulated microRNA-193b controls haematopoietic stem and progenitor cell expansion by modulating cytokine receptor signalling. Nat Commun. 2015 Nov 25;6:8928.
REF 11 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 12 MiR-34a-5p promotes the multi-drug resistance of osteosarcoma by targeting the CD117 gene. Oncotarget. 2016 May 10;7(19):28420-34.
REF 13 Repression of c-Kit by p53 is mediated by miR-34 and is associated with reduced chemoresistance, migration and stemness. Oncotarget. 2013 Sep;4(9):1399-415.
REF 14 The up-regulation of miR-199b-5p in erythroid differentiation is associated with GATA-1 and NF-E2. Mol Cells. 2014 Mar;37(3):213-9.
REF 15 Integrative nucleophosmin mutation-associated microRNA and gene expression pattern analysis identifies novel microRNA - target gene interactions in acute myeloid leukemia. Haematologica. 2011 Dec;96(12):1783-91.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.