Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T59686 Target Info
Target Name Methyl cpg binding protein 2 (MECP2)
Synonyms MethylCpGbinding protein 2; Methyl-CpG-binding protein 2; MeCp2 protein; MeCp2; MeCp-2 protein
Target Type Clinical trial Target
Gene Name MECP2
UniProt ID
P51608
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [1]
2 Luciferase Reporter Assay; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-155 can interfere with luciferase expression via direct interaction with both miR-155 recognition sites (located at positions 4679-4700 and 6305'U6328 bp) harbored within the MeCP2 3'UTR. [3]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [3]
2 Luciferase Reporter Assay; qRT-PCR; Microarray [4]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-212-3p miRNA Info
miRNA Mature AC
MIMAT0000269
Sequence uaacagucuccagucacggcc
miRNA Species Homo sapiens
Regulation Mechanism miR-212 repressed the construct with the MECP2 3'UTR. [7]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [7]
2 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Acetylcholinesterase (AChE) Target Info
ACES_HUMAN
Adenylate cyclase type 1 (ADCY1) Target Info
ADCY1_HUMAN
miRNA Mature ID hsa-miR-802 miRNA Info
miRNA Mature AC
MIMAT0004185
Sequence caguaacaaagauucauccuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-802 and the mutant construct co-transfection experiments demonstrated that miR-802 can interfere with luciferase expression via direct interaction with only the second miR-802 site (i.e. 6875'U6896 bp) in this in vitro surrogate assay. [3]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [3]
2 Luciferase Reporter Assay; qRT-PCR; Microarray [4]
Representative Target(s) Regulated by This miRNA Methyl cpg binding protein 2 (MECP2) Target Info
MECP2_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR of MECP2 is a target gene of miR-130a. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Northern Blot [11]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-30a-3p miRNA Info
miRNA Mature AC
MIMAT0000088
Sequence cuuucagucggauguuugcagc
miRNA Species Homo sapiens
Regulation Mechanism The epigenetic factor methyl-CpG-binding protein 2 (MeCP2) to be a direct and functional target of miR-30a-3p. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-432-5p miRNA Info
miRNA Mature AC
MIMAT0002814
Sequence ucuuggaguaggucauugggugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Methyl cpg binding protein 2 (MECP2) Target Info
MECP2_HUMAN
Nestin (NES) Target Info
NEST_HUMAN
References  Top
REF 1 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
REF 2 MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82.
REF 3 Chromosome 21-derived microRNAs provide an etiological basis for aberrant protein expression in human Down syndrome brains. J Biol Chem. 2010 Jan 8;285(2):1529-43.
REF 4 MicroRNAs in psychiatric and neurodevelopmental disorders. Brain Res. 2010 Jun 18;1338:78-88.
REF 5 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 6 Differential expression of PTEN-targeting microRNAs miR-19a and miR-21 in Cowden syndrome. Am J Hum Genet. 2008 May;82(5):1141-9.
REF 7 miR-212 is downregulated and suppresses methyl-CpG-binding protein MeCP2 in human gastric cancer. Int J Cancer. 2010 Sep 1;127(5):1106-14.
REF 8 SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients. Neurobiol Dis. 2015 May;77:127-40.
REF 9 MiR-130a regulates neurite outgrowth and dendritic spine density by targeting MeCP2. Protein Cell. 2016 Jul;7(7):489-500.
REF 10 Multiple-to-multiple relationships between microRNAs and target genes in gastric cancer. PLoS One. 2013 May 8;8(5):e62589.
REF 11 Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006 Apr 20;25(17):2537-45.
REF 12 MicroRNA-mediated epigenetic silencing of sirtuin1 contributes to impaired angiogenic responses. Circ Res. 2013 Sep 27;113(8):997-1003.
REF 13 MicroRNA-432 contributes to dopamine cocktail and retinoic acid induced differentiation of human neuroblastoma cells by targeting NESTIN and RCOR1 genes. FEBS Lett. 2014 May 2;588(9):1706-14.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.