Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T68009 Target Info
Target Name Vascular endothelial cadherin (CDH5)
Synonyms VE-cadherin; VE-cad; Cadherin-5; CD144 antigen; CD144; 7B4 antigen
Target Type Literature-reported Target
Gene Name CDH5
Biochemical Class Cadherin protein
UniProt ID
P33151
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism miR-211 targets CHD5. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism miR-27b targets the CDH5 mRNA 3'UTR to suppress expression of the protein. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
References  Top
REF 1 MicroRNA-211 expression promotes colorectal cancer cell growth in vitro and in vivo by targeting tumor suppressor CHD5. PLoS One. 2012;7(1):e29750.
REF 2 MicroRNA-27b functions as a new inhibitor of ovarian cancer-mediated vasculogenic mimicry through suppression of VE-cadherin expression. RNA. 2017 Jul;23(7):1019-1027.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.