The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuaaugcuaaucgugauagggguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acugcagugaaggcacuuguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
E-selectin (SELE)
|
Target Info
|
|
Integrin alpha-5 (ITGA5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-221-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agcuacauugucugcuggguuuc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-222-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agcuacaucuggcuacugggu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-31-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcaagaugcuggcauagcu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-31 regulates TNF-induced SELE expression by targeting the SELE 3'UTR. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Northern Blot; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 1 (CDK1)
|
Target Info
|
|
Dickkopf-related protein 1 (DKK1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-1256 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcauugacuucucacuagcu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
E-selectin (SELE)
|
Target Info
|
|
Intercellular adhesion molecule ICAM-1 (ICAM1)
|
Target Info
|
|