Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T92521 Target Info
Target Name Cytochrome P450 1B1 (CYP1B1)
Synonyms CYPIB1
Target Type Clinical trial Target
Gene Name CYP1B1
Biochemical Class Paired donor oxygen oxidoreductase
UniProt ID
Q16678
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-27b-3p by mature miRNA precursor transfection resulted in the decreased protein level of target CYP1B1; The Underexpression by Anti-miRNA Oligonucleotides resulted in the increased protein level of target CYP1B1. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot; Reporter Assay [1]
2 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-200c-5p miRNA Info
miRNA Mature AC
MIMAT0004657
Sequence cgucuuacccagcaguguuugg
miRNA Species Homo sapiens
Regulation Mechanism CYP1B1 is a direct target of miR-200c. miR-200c represses CYP1B1 mRNA expression resulting in the reduction of CYP1B1 protein level and enzymatic activity. [3]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Cytochrome P450 1B1 (CYP1B1) Target Info
CP1B1_HUMAN
Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
miRNA Mature ID hsa-miR-187-5p miRNA Info
miRNA Mature AC
MIMAT0004561
Sequence ggcuacaacacaggacccgggc
miRNA Species Homo sapiens
Regulation Mechanism The CYP1B1 was a direct target of miR-187-5p and promoted the growth and metastasis of NSCLC cells. CYP1B1 proto-oncogene is a target of miR-187-5p at specific 30-UTR sites. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Cytochrome P450 1B1 (CYP1B1) Target Info
CP1B1_HUMAN
References  Top
REF 1 MicroRNA regulates the expression of human cytochrome P450 1B1. Cancer Res. 2006 Sep 15;66(18):9090-8.
REF 2 Fumonisin B modulates expression of human cytochrome P450 1b1 in human hepatoma (Hepg2) cells by repressing Mir-27b. Toxicol Lett. 2014 May 16;227(1):50-5.
REF 3 Loss of miR-200c up-regulates CYP1B1 and confers docetaxel resistance in renal cell carcinoma. Oncotarget. 2015 Apr 10;6(10):7774-87.
REF 4 MicroRNA-187-5p suppresses cancer cell progression in non-small cell lung cancer (NSCLC) through down-regulation of CYP1B1. Biochem Biophys Res Commun. 2016 Sep 16;478(2):649-55.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.