Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T26203 Target Info
Target Name Intercellular adhesion molecule ICAM-1 (ICAM1)
Synonyms Major group rhinovirus receptor; Intercellular adhesion molecule 1; ICAM-1; CD54
Target Type Successful Target
Gene Name ICAM1
Biochemical Class Immunoglobulin
UniProt ID
P05362
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-221-3p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target CTGF. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-17-3p miRNA Info
miRNA Mature AC
MIMAT0000071
Sequence acugcagugaaggcacuuguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [4]
2 Northern Blot; Western Blot [2]
Representative Target(s) Regulated by This miRNA E-selectin (SELE) Target Info
LYAM2_HUMAN
Integrin alpha-5 (ITGA5) Target Info
ITA5_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-141-5p miRNA Info
miRNA Mature AC
MIMAT0004598
Sequence caucuuccaguacaguguugga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Intercellular adhesion molecule ICAM-1 (ICAM1) Target Info
ICAM1_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism mRNA expression of ICAM1 was negatively regulated by miR-146a. [6]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21 inhibited the expression of ICAM1 constructs. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-324-3p miRNA Info
miRNA Mature AC
MIMAT0000762
Sequence cccacugccccaggugcugcugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
CREB-binding protein (CREBBP) Target Info
CBP_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [8]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-1256 miRNA Info
miRNA Mature AC
MIMAT0005907
Sequence aggcauugacuucucacuagcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA E-selectin (SELE) Target Info
LYAM2_HUMAN
Intercellular adhesion molecule ICAM-1 (ICAM1) Target Info
ICAM1_HUMAN
miRNA Mature ID hsa-miR-296-3p miRNA Info
miRNA Mature AC
MIMAT0004679
Sequence gaggguuggguggaggcucucc
miRNA Species Homo sapiens
Regulation Mechanism miR-296-3p inhibits ICAM-1 by directly targeting its 3'UTR. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA C-X3-C chemokine receptor 1 (CX3CR1) Target Info
CX3C1_HUMAN
Intercellular adhesion molecule ICAM-1 (ICAM1) Target Info
ICAM1_HUMAN
References  Top
REF 1 Resveratrol attenuates ICAM-1 expression and monocyte adhesiveness to TNF--treated endothelial cells: evidence for an anti-inflammatory cascade mediated by the miR-221/222/AMPK/p38/NF-B pathway. Sci Rep. 2017 Mar 24;7:44689.
REF 2 Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5.
REF 3 miR-221 suppresses ICAM-1 translation and regulates interferon-gamma-induced ICAM-1 expression in human cholangiocytes. Am J Physiol Gastrointest Liver Physiol. 2010 Apr;298(4):G542-50.
REF 4 The effects of perfluorocarbon on ICAM-1 expression in LPS-induced A549 cells and the potential mechanism. Mol Med Rep. 2016 Apr;13(4):3700-8.
REF 5 MicroRNA-141 regulates the expression level of ICAM-1 on endothelium to decrease myocardial ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol. 2015 Oct;309(8):H1303-13.
REF 6 Regulation of retinal inflammation by rhythmic expression of MiR-146a in diabetic retina. Invest Ophthalmol Vis Sci. 2014 May 27;55(6):3986-94.
REF 7 Induction of miR-21 by retinoic acid in estrogen receptor-positive breast carcinoma cells: biological correlates and molecular targets. J Biol Chem. 2011 Feb 4;286(5):4027-42.
REF 8 Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.
REF 9 MiRNA-296-3p-ICAM-1 axis promotes metastasis of prostate cancer by possible enhancing survival of natural killer cell-resistant circulating tumour cells. Cell Death Dis. 2013 Nov 21;4:e928.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.