Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T28025 Target Info
Target Name Proto-oncogene c-Fos (c-Fos)
Synonyms G0S7; G0/G1 switch regulatory protein 7; Cellular oncogene fos; C-fos
Target Type Literature-reported Target
Gene Name FOS
Biochemical Class Basic leucine zipper bZIP
UniProt ID
P01100
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Regulation Mechanism miR-139 might directly target c-Fos in HCC cells. [2]
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [1]
2 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot; Northern Blot [4]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot; Northern Blot [4]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-490-5p miRNA Info
miRNA Mature AC
MIMAT0004764
Sequence ccauggaucuccaggugggu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
PI3-kinase alpha (PIK3CA) Target Info
PK3CA_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Downregulation of miR-146a resulted in the increased protein level of Fos. [7]
Evidence Score (E-score) 1 +
1 Immunoblot [7]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [8]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-196b-5p miRNA Info
miRNA Mature AC
MIMAT0001080
Sequence uagguaguuuccuguuguuggg
miRNA Species Homo sapiens
Regulation Mechanism Forced expression of miR-196b inhibited the FOS promoter and AP-1 reporter activity. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism Expression of miR-34a resulted in a decreased levels of c-Fos protein suggesting that miR-34a interfered with c-Fos translation. [10]
Evidence Score (E-score) 1 +
1 Western Blot [10]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
References  Top
REF 1 MiR-139-5p is associated with inflammatory regulation through c-FOS suppression, and contributes to the progression of primary biliary cholangitis. Lab Invest. 2016 Nov;96(11):1165-1177.
REF 2 Derepression of c-Fos caused by microRNA-139 down-regulation contributes to the metastasis of human hepatocellular carcinoma. Cell Biochem Funct. 2013 Jun;31(4):319-24.
REF 3 The abrogation of the HOXB7/PBX2 complex induces apoptosis in melanoma through the miR-221&222-c-FOS pathway. Int J Cancer. 2013 Aug 15;133(4):879-92.
REF 4 MicroRNA-34a inhibits cell proliferation by repressing mitogen-activated protein kinase kinase 1 during megakaryocytic differentiation of K562 cells. Mol Pharmacol. 2010 Jun;77(6):1016-24.
REF 5 MicroRNA-490-5p inhibits proliferation of bladder cancer by targeting c-Fos. Biochem Biophys Res Commun. 2013 Nov 29;441(4):976-81.
REF 6 MicroRNA-490-5p is a novel tumor suppressor targeting c-FOS in human bladder cancer. Arch Med Sci. 2015 Jun 19;11(3):561-9.
REF 7 miR-146a targets Fos expression in human cardiac cells. Dis Model Mech. 2015 Sep;8(9):1081-91.
REF 8 Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61.
REF 9 miR-196b Is Epigenetically Silenced during the Premalignant Stage of Lung Carcinogenesis. Cancer Res. 2016 Aug 15;76(16):4741-51.
REF 10 Reduction of c-Fos via Overexpression of miR-34a Results in Enhancement of TNF- Production by LPS in Neutrophils from Myelodysplastic Syndrome Patients. PLoS One. 2016 Aug 11;11(8):e0158527.
REF 11 MiR-449a suppresses the epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma by multiple targets. BMC Cancer. 2015 Oct 15;15:706.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.