Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T71081 Target Info
Target Name GTPase HRas (HRAS)
Synonyms p21ras; cHras; c-H-ras; Transforming protein p21; HaRas; Ha-Ras; H-Ras-1; GTPase HRas, Nterminally processed
Target Type Literature-reported Target
Gene Name HRAS
Biochemical Class Small GTPase
UniProt ID
P01112
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism K-Ras oncogene is a target of miRNA-143. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Northern Blot; qRT-PCR [1]
2 Luciferase Reporter Assay; Northern Blot; qRT-PCR [2]
3 qRT-PCR; In Situ Hybridization; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-let-7a-5p miRNA Info
miRNA Mature AC
MIMAT0000062
Sequence ugagguaguagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target HRAS. [4]
Evidence Score (E-score) 1 +
1 Western Blot [4]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
GTPase HRas (HRAS) Target Info
RASH_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot; Western Blot [5]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-663a miRNA Info
miRNA Mature AC
MIMAT0003326
Sequence aggcggggcgccgcgggaccgc
miRNA Species Homo sapiens
Regulation Mechanism HRAS is one of the genes targeted by miR-663. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
miRNA Mature ID hsa-miR-181d-5p miRNA Info
miRNA Mature AC
MIMAT0002821
Sequence aacauucauuguugucggugggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
GTPase HRas (HRAS) Target Info
RASH_HUMAN
References  Top
REF 1 The Evi1, microRNA-143, K-Ras axis in colon cancer. FEBS Lett. 2011 Feb 18;585(4):693-9.
REF 2 MicroRNA-143 targets DNA methyltransferases 3A in colorectal cancer. Br J Cancer. 2009 Aug 18;101(4):699-706.
REF 3 Tumor suppressors miR-143 and miR-145 and predicted target proteins API5, ERK5, K-RAS, and IRS-1 are differentially expressed in proximal and distal colon. Am J Physiol Gastrointest Liver Physiol. 2015 Feb 1;308(3):G179-87.
REF 4 Lin28-let7 modulates radiosensitivity of human cancer cells with activation of K-Ras. Int J Radiat Oncol Biol Phys. 2010 Jan 1;76(1):5-8.
REF 5 IMP-1 displays cross-talk with K-Ras and modulates colon cancer cell survival through the novel proapoptotic protein CYFIP2. Cancer Res. 2011 Mar 15;71(6):2172-82.
REF 6 miR-139-5p is a regulator of metastatic pathways in breast cancer. RNA. 2013 Dec;19(12):1767-80.
REF 7 The epigenetically-regulated miR-663 targets H-ras in K-562 cells. FEBS J. 2013 Oct;280(20):5109-17.
REF 8 MiR-181d acts as a tumor suppressor in glioma by targeting K-ras and Bcl-2. J Cancer Res Clin Oncol. 2012 Apr;138(4):573-84.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.