Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T78319 Target Info
Target Name Extracellular matrix receptor III (CD44)
Synonyms Phagocytic glycoprotein I; Phagocytic glycoprotein 1; PGP-I; PGP-1; MIC4; MDU3; MDU2; LHR; Hyaluronate receptor; Hermes antigen; Heparan sulfate proteoglycan; HUTCH-I; GP90 lymphocyte homing/adhesion receptor; Extracellular matrix receptor-III; Epican; ECMR-III; CDw44; CD44 antigen
Target Type Clinical trial Target
Gene Name CD44
UniProt ID
P16070
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-34a-5p by Anti-miRNA resulted in the changed protein level of target CD44. [4]
Evidence Score (E-score) 7 +
1 Immunohistochemistry; qRT-PCR; Western Blot; Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 qRT-PCR; Western Blot [5]
6 qRT-PCR; Western Blot [6]
7 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-328-3p miRNA Info
miRNA Mature AC
MIMAT0000752
Sequence cuggcccucucugcccuuccgu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-328-3p by mature miRNA precursor transfection resulted in the decreased protein level of target CD44. [4]
Evidence Score (E-score) 4 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
2 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
3 Immunohistochemistry; qRT-PCR [9]
4 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Regulation Mechanism The mutation of miR-373-3p resulted in the unchanged mRNA level of target CD44; The miRNA Overexpression resulted in the decreased protein level of target CD44. [4]
Evidence Score (E-score) 3 +
1 ChIP; Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
2 ChIP; Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
3 qRT-PCR; Western Blot; Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-520c-3p miRNA Info
miRNA Mature AC
MIMAT0002846
Sequence aaagugcuuccuuuuagagggu
miRNA Species Homo sapiens
Regulation Mechanism miR-520c promote cell migration and invasion in part by limiting CD44 expression directly. [4]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
2 Luciferase Reporter Assay; Western Blot [4]
3 qRT-PCR; Western Blot; Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism Re-expression of CD44 can partially revert a decrease in transformation properties caused by the overexpression of miR- 143. [15]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [14]
2 Luciferase Reporter Assay; Western Blot [15]
3 qRT-PCR; Western Blot [16]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism Re-expression of CD44 can partially revert a decrease in transformation properties caused by the overexpression of miR- 145. [15]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [17]
2 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-216a-5p miRNA Info
miRNA Mature AC
MIMAT0000273
Sequence uaaucucagcuggcaacuguga
miRNA Species Homo sapiens
Regulation Mechanism miR-216a binds to both the CD44 3'UTR. [18]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-330-3p miRNA Info
miRNA Mature AC
MIMAT0000751
Sequence gcaaagcacacggccugcagaga
miRNA Species Homo sapiens
Regulation Mechanism miR-330 binds to both the CD44 3'UTR. [18]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-520a-3p miRNA Info
miRNA Mature AC
MIMAT0002834
Sequence aaagugcuucccuuuggacugu
miRNA Species Homo sapiens
Regulation Mechanism Luciferase assay was used to confirm that CD44 is the a direct target gene of miR-520a-3p. [19]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism CD44 is a direct target of miR-708 in prostate cancer. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [20]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-608 miRNA Info
miRNA Mature AC
MIMAT0003276
Sequence aggggugguguugggacagcuccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-608 binds to both the CD44 3'UTR. [18]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-328-5p miRNA Info
miRNA Mature AC
MIMAT0026486
Sequence gggggggcaggaggggcucaggg
miRNA Species Homo sapiens
Regulation Mechanism The expression level of miR-328 can function as a predictive biomarker of recurrence after ECD in patients with EGC via targeting CD44. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [21]
Representative Target(s) Regulated by This miRNA Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
References  Top
REF 1 The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nat Med. 2011 Feb;17(2):211-5.
REF 2 MicroRNA-34a functions as an anti-metastatic microRNA and suppresses angiogenesis in bladder cancer by directly targeting CD44. J Exp Clin Cancer Res. 2014 Dec 31;33:779.
REF 3 Cisplatin-induced epigenetic activation of miR-34a sensitizes bladder cancer cells to chemotherapy. Mol Cancer. 2014 Jan 15;13:8.
REF 4 The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis. Nat Cell Biol. 2008 Feb;10(2):202-10.
REF 5 Nanovesicle-mediated systemic delivery of microRNA-34a for CD44 overexpressing gastric cancer stem cell therapy. Biomaterials. 2016 Oct;105:12-24.
REF 6 Registered report: the microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Elife. 2015 Jul 31;4:e06434.
REF 7 Anti-proliferative effects of polyphenols from pomegranate rind (Punica granatum L.) on EJ bladder cancer cells via regulation of p53/miR-34a axis. Phytother Res. 2015 Mar;29(3):415-22.
REF 8 Macrophage-derived reactive oxygen species suppress miR-328 targeting CD44 in cancer cells and promote redox adaptation. Carcinogenesis. 2014 May;35(5):1003-11.
REF 9 Chronic inflammation with Helicobacter pylori infection is implicated in CD44 overexpression through miR-328 suppression in the gastric mucosa. J Gastroenterol. 2015 Jul;50(7):751-7.
REF 10 MicroRNA miR-328 regulates zonation morphogenesis by targeting CD44 expression. PLoS One. 2008 Jun 18;3(6):e2420.
REF 11 Isoproterenol regulates CD44 expression in gastric cancer cells through STAT3/MicroRNA373 cascade. Biomaterials. 2016 Oct;105:89-101.
REF 12 MicroRNAs 373 and 520c are downregulated in prostate cancer, suppress CD44 translation and enhance invasion of prostate cancer cells in vitro. Int J Clin Exp Pathol. 2009;2(4):361-9.
REF 13 Endogenous and exogenous miR-520c-3p modulates CD44-mediated extravillous trophoblast invasion. Placenta. 2017 Feb;50:25-31.
REF 14 MicroRNA 43 targets CD44 to inhibit breast cancer progression and stem cell-like properties. Mol Med Rep. 2016 Jun;13(6):5193-9.
REF 15 Analysis of the combined action of miR-143 and miR-145 on oncogenic pathways in colorectal cancer cells reveals a coordinate program of gene repression. Oncogene. 2013 Oct;32(40):4806-13.
REF 16 miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47.
REF 17 MicroRNA-145 exerts tumor-suppressive and chemo-resistance lowering effects by targeting CD44 in gastric cancer. World J Gastroenterol. 2017 Apr 7;23(13):2337-2345.
REF 18 Expression of CD44 3'-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis. Nucleic Acids Res. 2011 Apr;39(8):3026-41.
REF 19 Suppressing role of miR-520a-3p in breast cancer through CCND1 and CD44. Am J Transl Res. 2017 Jan 15;9(1):146-154.
REF 20 miRNA-708 control of CD44(+) prostate cancer-initiating cells. Cancer Res. 2012 Jul 15;72(14):3618-30.
REF 21 Expression of microRNA-328 Functions as a Biomarker for Recurrence of Early Gastric Cancer (EGC) After Endoscopic Submucosal Dissection (ESD) by Modulating CD44. Med Sci Monit. 2016 Dec 6;22:4779-4785.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.