Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T84616 Target Info
Target Name Beclin-1 (BECN1)
Synonyms Protein GT197; GT197; Coiledcoil myosinlike BCL2interacting protein; Coiled-coil myosin-like BCL2-interacting protein
Target Type Literature-reported Target
Gene Name BECN1
UniProt ID
Q14457
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Regulation Mechanism miR-142a-5p target the 3'UTR of BECN1mRNA to inhibit its protein translation in PECs. [5]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay [4]
2 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-216b-5p miRNA Info
miRNA Mature AC
MIMAT0004959
Sequence aaaucucugcaggcaaauguga
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity of Beclin1 wild-type 30UTR construct was decreased by the transfection of miR-216b. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
miRNA Mature ID hsa-miR-30b-5p miRNA Info
miRNA Mature AC
MIMAT0000420
Sequence uguaaacauccuacacucagcu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 GFP Reporter Assay; Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
2 HITS-CLIP [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-216a-5p miRNA Info
miRNA Mature AC
MIMAT0000273
Sequence uaaucucagcuggcaacuguga
miRNA Species Homo sapiens
Regulation Mechanism BECN1 is a direct target of miR-216a. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism BECN1 is a potential target of miR-221. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-30a-3p miRNA Info
miRNA Mature AC
MIMAT0000088
Sequence cuuucagucggauguuugcagc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [12]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
miRNA Mature ID hsa-miR-30d-5p miRNA Info
miRNA Mature AC
MIMAT0000245
Sequence uguaaacauccccgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism miR-30d regulate multiple genes in the autophagy pathway including BECN1. Expression of BECN1 protein in the autophagy pathway was directly suppressed by mir-30d in cancer cells. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA Autophagy-related 2B (ATG2B) Target Info
ATG2B_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [14]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-30b-3p miRNA Info
miRNA Mature AC
MIMAT0004589
Sequence cugggagguggauguuuacuuc
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-30b mimics inhibited BECN1 protein expression. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Nuclear receptor ROR-gamma (RORG) Target Info
RORG_HUMAN
miRNA Mature ID hsa-miR-376b-3p miRNA Info
miRNA Mature AC
MIMAT0002172
Sequence aucauagaggaaaauccauguu
miRNA Species Homo sapiens
Regulation Mechanism miR-376b controls autophagy by directly regulating intracellular levels of key autophagy protein BECN1. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [16]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
References  Top
REF 1 Endothelial Cell Autophagy in Atherosclerosis is Regulated by miR-30-Mediated Translational Control of ATG6. Cell Physiol Biochem. 2015;37(4):1369-78.
REF 2 Has-miR-30a regulates autophagic activity in cervical cancer upon hydroxycamptothecin exposure. Biomed Pharmacother. 2015 Oct;75:67-74.
REF 3 Regulation of autophagy by a beclin 1-targeted microRNA, miR-30a, in cancer cells. Autophagy. 2009 Aug;5(6):816-23.
REF 4 MicroRNA-216a enhances the radiosensitivity of pancreatic cancer cells by inhibiting beclin-1-mediated autophagy. Oncol Rep. 2015 Sep;34(3):1557-64.
REF 5 Mesenchymal Stem Cells Alleviate LPS-Induced Acute Lung Injury in Mice by MiR-142a-5p-Controlled Pulmonary Endothelial Cell Autophagy. Cell Physiol Biochem. 2016;38(1):258-66.
REF 6 Colorectal cancer cells are resistant to anti-EGFR monoclonal antibody through adapted autophagy. Am J Transl Res. 2016 Feb 15;8(2):1190-6.
REF 7 MicroRNA-216b/Beclin 1 axis regulates autophagy and apoptosis in human Tenon's capsule fibroblasts upon hydroxycamptothecin exposure. Exp Eye Res. 2014 Jun;123:43-55.
REF 8 Compromised autophagy by MIR30B benefits the intracellular survival of Helicobacter pylori. Autophagy. 2012 Jul 1;8(7):1045-57.
REF 9 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 10 MiR-216a: a link between endothelial dysfunction and autophagy. Cell Death Dis. 2014 Jan 30;5:e1029.
REF 11 mda-7/IL-24 Mediates Cancer Cell-Specific Death via Regulation of miR-221 and the Beclin-1 Axis. Cancer Res. 2017 Feb 15;77(4):949-959.
REF 12 MiRNA-30a-mediated autophagy inhibition sensitizes renal cell carcinoma cells to sorafenib. Biochem Biophys Res Commun. 2015 Apr 3;459(2):234-239.
REF 13 mir-30d Regulates multiple genes in the autophagy pathway and impairs autophagy process in human cancer cells. Biochem Biophys Res Commun. 2013 Feb 15;431(3):617-22.
REF 14 Chitosan nanoparticle-mediated delivery of miRNA-34a decreases prostate tumor growth in the bone and its expression induces non-canonical autophagy. Oncotarget. 2015 Oct 6;6(30):29161-77.
REF 15 MicroRNA-30b Regulates High Phosphorus Level-Induced Autophagy in Vascular Smooth Muscle Cells by Targeting BECN1. Cell Physiol Biochem. 2017;42(2):530-536.
REF 16 miR-376b controls starvation and mTOR inhibition-related autophagy by targeting ATG4C and BECN1. Autophagy. 2012 Feb 1;8(2):165-76.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.