Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T32578 Target Info
Target Name Interleukin-6 (IL6)
Synonyms Interferon beta-2; IL-6; IFNB2; IFN-beta-2; Hybridoma growth factor; CTL differentiation factor; CDF; BSF-2; B-cell stimulatory factor 2
Target Type Successful Target
Gene Name IL6
Biochemical Class Cytokine: interleukin
UniProt ID
P05231
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Microarray [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism IL-6 expression was decreased in let-7c precursor-transfected cells and increased in anti-miR-let-7-transfected cells. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; ELISA [4]
2 Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-142-3p miRNA Info
miRNA Mature AC
MIMAT0000434
Sequence uguaguguuuccuacuuuaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 ELISA; Immunoblot [6]
2 Immunofluorescence; RT-PCR [7]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
High mobility group protein B1 (HMGB1) Target Info
HMGB1_HUMAN
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
MIMAT0002809
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Regulation Mechanism miR-146b-5p inhibits IL-6 expression through a specific sequence at the IL-6 3'UTR. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [8]
2 Western Blot [9]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
S10AC_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-136-5p miRNA Info
miRNA Mature AC
MIMAT0000448
Sequence acuccauuuguuuugaugaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-136 targets the IL-6 3' UTR, but enhances IL-6 expression. [10]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [10]
2 Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Interleukin-6 (IL6) Target Info
IL6_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [11]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism miRNA-107 target IL-6R and also inhibit IL-6 signaling and impair STAT3 activation in human hepatocytes. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Co-Immunoprecipitation [12]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-125a-3p miRNA Info
miRNA Mature AC
MIMAT0004602
Sequence acaggugagguucuugggagcc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
Fyn tyrosine protein kinase (FYN) Target Info
FYN_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-149-5p miRNA Info
miRNA Mature AC
MIMAT0000450
Sequence ucuggcuccgugucuucacuccc
miRNA Species Homo sapiens
Regulation Mechanism miR-149 inhibited fibroblast activation by targeting IL-6. [15]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism High expression of miR-203 in RASFs leads to increased secretion of IL-6. [16]
Evidence Score (E-score) 1 +
1 ELISA [16]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism miR-223 directly targets the chemoattractants IL-6. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [17]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-365a-3p miRNA Info
miRNA Mature AC
MIMAT0000710
Sequence uaaugccccuaaaaauccuuau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [18]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
References  Top
REF 1 Dysregulated miR-98 Contributes to Extracellular Matrix Degradation by Targeting IL-6/STAT3 Signaling Pathway in Human Intervertebral Disc Degeneration. J Bone Miner Res. 2016 Apr;31(4):900-9.
REF 2 miR-98 protects endothelial cells against hypoxia/reoxygenation induced-apoptosis by targeting caspase-3. Biochem Biophys Res Commun. 2015 Nov 20;467(3):595-601.
REF 3 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
REF 4 Loss of let-7 microRNA upregulates IL-6 in bone marrow-derived mesenchymal stem cells triggering a reactive stromal response to prostate cancer. PLoS One. 2013 Aug 19;8(8):e71637.
REF 5 Elevation of Il6 is associated with disturbed let-7 biogenesis in a genetic model of depression. Transl Psychiatry. 2016 Aug 16;6:e869.
REF 6 Targeting of microRNA-142-3p in dendritic cells regulates endotoxin-induced mortality. Blood. 2011 Jun 9;117(23):6172-83.
REF 7 Generation and Validation of miR-142 Knock Out Mice. PLoS One. 2015 Sep 1;10(9):e0136913.
REF 8 miR-146b-5p mediates p16-dependent repression of IL-6 and suppresses paracrine procarcinogenic effects of breast stromal fibroblasts. Oncotarget. 2015 Oct 6;6(30):30006-16.
REF 9 Modulation of inflammatory markers by miR-146a during replicative senescence in trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2010 Jun;51(6):2976-85.
REF 10 Identification of cellular microRNA-136 as a dual regulator of RIG-I-mediated innate immunity that antagonizes H5N1 IAV replication in A549 cells. Sci Rep. 2015 Oct 9;5:14991.
REF 11 The Effects and Molecular Mechanisms of MiR-106a in Multidrug Resistance Reversal in Human Glioma U87/DDP and U251/G Cell Lines. PLoS One. 2015 May 7;10(5):e0125473.
REF 12 Hepatitis C virus-induced changes in microRNA 107 (miRNA-107) and miRNA-449a modulate CCL2 by targeting the interleukin-6 receptor complex in hepatitis. J Virol. 2014 Apr;88(7):3733-43.
REF 13 Rs12976445 Polymorphism is Associated with Risk of Diabetic Nephropathy Through Modulating Expression of MicroRNA-125 and Interleukin-6R. Med Sci Monit. 2015 Nov 13;21:3490-7.
REF 14 Dysregulation in microRNA expression in peripheral blood mononuclear cells of sepsis patients is associated with immunopathology. Cytokine. 2015 Jan;71(1):89-100.
REF 15 Epigenetic silencing of microRNA-149 in cancer-associated fibroblasts mediates prostaglandin E2/interleukin-6 signaling in the tumor microenvironment. Cell Res. 2015 May;25(5):588-603.
REF 16 Altered expression of microRNA-203 in rheumatoid arthritis synovial fibroblasts and its role in fibroblast activation. Arthritis Rheum. 2011 Feb;63(2):373-81.
REF 17 MicroRNA-223 controls susceptibility to tuberculosis by regulating lung neutrophil recruitment. J Clin Invest. 2013 Nov;123(11):4836-48.
REF 18 miR-365, a novel negative regulator of interleukin-6 gene expression, is cooperatively regulated by Sp1 and NF-kappaB. J Biol Chem. 2011 Jun 17;286(24):21401-12.
REF 19 miR-451 acts as a suppressor of angiogenesis in hepatocellular carcinoma by targeting the IL-6R-STAT3 pathway. Oncol Rep. 2016 Sep;36(3):1385-92.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.